spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 19 March 2009
doi: 10.1242/jcs.035238


Journal of Cell Science 122, 1134-1144 (2009)
Published by The Company of Biologists 2009
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.035238v1
122/8/1134    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fant, X.
Right arrow Articles by Merdes, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fant, X.
Right arrow Articles by Merdes, A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Research Article

Stability of the small {gamma}-tubulin complex requires HCA66, a protein of the centrosome and the nucleolus

Xavier Fant1, Nicole Gnadt1, Laurence Haren2 and Andreas Merdes1,2,*

1 Wellcome Trust Centre for Cell Biology, University of Edinburgh, Mayfield Road, Edinburgh EH9 3JR, UK
2 Centre National de la Recherche Scientifique–Pierre Fabre, 3 rue des Satellites, 31400 Toulouse, France

* Author for correspondence (e-mail: andreas.merdes{at}istmt.cnrs.fr)

Accepted 16 December 2008


    Summary
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
To investigate changes at the centrosome during the cell cycle, we analyzed the composition of the pericentriolar material from unsynchronized and S-phase-arrested cells by gel electrophoresis and mass spectrometry. We identified HCA66, a protein that localizes to the centrosome from S-phase to mitosis and to the nucleolus throughout interphase. Silencing of HCA66 expression resulted in failure of centrosome duplication and in the formation of monopolar spindles, reminiscent of the phenotype observed after {gamma}-tubulin silencing. Immunofluorescence microscopy showed that proteins of the {gamma}-tubulin ring complex were absent from the centrosome in these monopolar spindles. Immunoblotting revealed reduced protein levels of all components of the {gamma}-tubulin small complex ({gamma}-tubulin, GCP2, and GCP3) in HCA66-depleted cells. By contrast, the levels of {gamma}-tubulin ring complex proteins such as GCP4 and GCP-WD/NEDD1 were unaffected. We propose that HCA66 is a novel regulator of {gamma}-tubulin function that plays a role in stabilizing components of the {gamma}-tubulin small complex, which is in turn essential for assembling the larger {gamma}-tubulin ring complex.

Key words: Centrosome, {gamma}-Tubulin, Mitosis, Monopolar, Spindle


    Introduction
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
The centrosome constitutes a major microtubule-organizing centre in animal cells. Microtubules are nucleated and anchored at the surface of the centrosome, at the pericentriolar material. {gamma}-Tubulin is a major component of the pericentriolar material and supports microtubule nucleation. It is in dynamic exchange with a free cytoplasmic pool (Khodjakov and Rieder, 1999Go), and is found in two major protein complexes (Oegema et al., 1999Go): a small `{gamma}-TuSC' ({gamma}-tubulin small complex), containing two molecules of {gamma}-tubulin associated with one molecule each of the {gamma}-tubulin complex proteins GCP2 and GCP3; furthermore, a large `{gamma}-TuRC' ({gamma}-tubulin ring complex), consisting of multiple {gamma}-TuSCs and additional proteins, including GCP4, GCP5 and GCP6 (for a review, see Raynaud-Messina and Merdes, 2007Go). The amount of {gamma}-tubulin at the centrosome is regulated during the cell cycle and increases sharply at the beginning of mitosis, when spindle formation requires an increase in microtubule nucleation activity (Zheng et al., 1991Go; Lajoie-Mazenc et al., 1994Go; Khodjakov and Rieder, 1999Go). After completion of mitosis, the amounts of centrosome-bound {gamma}-tubulin are reduced to interphase levels. So far, the mechanisms that regulate {gamma}-tubulin-dependent activity are only partly understood. Several kinases have been implicated in regulating the recruitment of {gamma}-tubulin to the centrosome, such as Aurora A and Plk1 (Lane and Nigg, 1996Go; Hannak et al., 2001Go; Berdnik and Knoblich, 2002Go; Terada et al., 2003Go). Moreover, the cell cycle-dependent recruitment of {gamma}-tubulin complexes depends on proteins of the pericentriolar material such as pericentrin, ninein or ninein-like protein (Takahashi et al., 2002Go; Casenghi et al., 2003Go; Chen et al., 2003Go; Zimmerman et al., 2004Go; Delgehyr et al., 2005Go). Whereas pericentrin recruits increased amounts of {gamma}-tubulin complexes to the mitotic centrosome via GCP2 and GCP3, ninein and ninein-like protein anchor {gamma}-tubulin preferably during interphase but are displaced during mitosis in a phosphorylation-dependent manner. Recruitment of {gamma}-tubulin in mammalian cells may be further supported by a protein that associates with the {gamma}-tubulin ring complex and that attaches to the centrosome, termed GCP-WD or NEDD1 (Lüders et al., 2006Go; Haren et al., 2006Go).

To identify novel proteins that are responsible for cell cycle-dependent regulation of {gamma}-tubulin, we compared the composition of the pericentriolar material at different phases of the cell cycle. We characterized HCA66 as a protein of the nucleolus that associates with the centrosome specifically from S-phase to mitosis. HCA66 has initially been identified as an autoimmune antigen in hepatocellular carcinomas, and has recently been found to bind to the protein Apaf-1 of the apoptosis pathway (Wang et al., 2002Go; Piddubnyak et al., 2007Go). In the present study, we demonstrate that HCA66 is required for the stability of {gamma}-TuSC proteins, and that silencing of HCA66 expression produces defects in centriole duplication and spindle microtubule assembly.


    Results
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
HCA66 is a nucleolar protein that associates transiently with the centrosome
To study changes at the centrosome during the cell cycle, we compared the protein composition of the pericentriolar material from unsynchronized Jurkat cells (66% in G1 phase, 25% in S phase, as verified by flow cytometry), and from Jurkat cells arrested in S phase by a double aphidicolin block (85% in S phase, 10% in G1). Centrosomes were isolated after lysis using a sucrose gradient, and centrosome-containing fractions were pooled and extracted with 1 M potassium iodide to solubilize the pericentriolar material. The soluble pericentriolar material obtained from unsynchronized cells (`async') or from S-phase-arrested cells (`S') was then compared by gel electrophoresis (Fig. 1A). Bands with significantly increased intensity in S phase were investigated by MALDI-tof mass spectrometry. One of these bands (Fig. 1A) was identified as hepatocellular carcinoma-associated antigen 66 (HCA66), a protein of 597 amino acids. Database searches revealed highly homologous sequences from ESTs in mouse, Drosophila and budding yeast. Alignment of HCA66 protein sequences (supplementary material Fig. S1) showed that the N-terminal half of HCA66 (amino acids 1-202) is the most conserved region within the protein (30% identity + 31% conservative exchanges between budding yeast and human), suggesting an important role of this region for the function of the protein. Structure prediction software identified seven HAT repeats in HCA66 (Fig. 1B). These are `half-a-tetratrico-peptide' repeats with structural similarities to TPR and HEAT repeats; each repeat is predicted to form two short amphipathic {alpha}-helices connected by a loop (Preker and Keller, 1998Go). HAT repeats in HCA66 were found between amino acids 87-119, 121-153, 156-188, 304-335, 452-486, 488-520 and 524-557. This type of repeats is thought to be involved in protein-protein interactions.


Figure 1
View larger version (36K):
[in this window]
[in a new window]

 
Fig. 1. HCA66 is a novel protein of the nucleolus and the centrosome. (A) Silver stained SDS-PAGE of pericentriolar material extracted from centrosomes of asynchronous Jurkat cells (async) or cells arrested in S phase (S). The arrowhead shows the band identified as HCA66. The sizes of the molecular weight markers (Mr) are indicated on the right. (B) Schematic representation of human HCA66, showing seven predicted HAT repeats (black boxes). Amino acid positions of the N and C termini (1 and 597), and the repeats are indicated. The region of HCA66 used for immunization of rabbits is indicated with a black line. (C) Immunoblots of whole cell lysates from HeLa and U-2 OS cells. Left: HeLa lysate probed with anti-HCA66 antibody (imm.) or the corresponding pre-immune serum (pre.). Right: lysates of regular U-2 OS cells or cells expressing GFP-HCA66, probed with anti-HCA66. Black arrowhead indicates HCA66, white arrowhead indicates GFP:HCA66. The positions of molecular weight markers (Mr) are indicated. (D) Immunoblots of U-2 OS cells after fractionation in buffer containing 50 mM Tris (pH 6.8), 250 mM NaCl and the detergents Triton X-100 and deoxycholate (DOC) at increasing concentrations, as indicated. s, supernatant; p, pellet. (E) Immunofluorescence of U-2 OS cells stained with antibodies against endogenous HCA66, or transfected with GFP:HCA66. Cells were co-stained with antibodies against {gamma}-tubulin or nucleophosmin (NPM). Nucleolar HCA66 is not in focus in the cell depicted in the second row. Arrowheads indicate the position of the centrosome. Scale bars: 10 µm.

 

An antibody raised against a bacterially expressed fragment of HCA66 recognized a single protein band of ~62 kDa on immunoblots of HeLa cell lysates (Fig. 1C). Equivalent immunoblotting results were obtained in U-2 OS cells (Fig. 1C). Moreover, our antibody recognized a higher molecular weight band in lysates from U-2 OS cells overexpressing GFP:HCA66, corresponding to the GFP-tagged protein (Fig. 1C). Fractionation of cells with salt and detergent revealed that HCA66 is largely insoluble. Most of HCA66 was found in the pellet after extraction and centrifugation (Fig. 1D), and visual inspection revealed that all nuclei accumulated in these fractions. Immunofluorescence experiments with our HCA66 antibody revealed a strong staining of the nucleolus, colocalizing with the marker nucleophosmin (Fig. 1E). Consistently, proteomic analysis identified HCA66 as a nucleolar component (Andersen et al., 2005Go). Our immunofluorescence data further revealed one or two discrete dots in the cytoplasm that colocalized with the centrosomal marker {gamma}-tubulin (Fig. 1E). Expression of a GFP:HCA66 fusion construct confirmed the dual localization of HCA66 at the nucleolus and at the centrosome (Fig. 1E). We then tested by microscopy whether the association of HCA66 with the centrosome is cell cycle dependent, as indicated by our biochemical data on purified centrosomes (Fig. 1A). We found that U-2 OS cells that were synchronized in S phase and that were pulse labelled with bromo-deoxyuridine displayed HCA66 localization at the centrosome in 91% (±5, n=250) of the cells, whereas in cultures synchronized in G1 phase only 24% (±7, n=250) of the cells showed detectable centrosomal staining (Fig. 2A). This suggests that HCA66 localizes to the centrosome in a cell cycle-dependent manner, and that most of HCA66 at the centrosome is recruited at the G1-S transition. HCA66 remains at the centrosome until metaphase. From anaphase onwards, centrosomal localization of HCA66 is lost, and in telophase HCA66 relocalizes to the nucleoli (Fig. 2B). Experiments using nocodazole indicated that centrosome localization does not depend on polymerized microtubules (Fig. 2C). Moreover, HCA66 does not bind to acentriolar microtubule asters induced by taxol treatment of mitotic cells (Fig. 2C). Taken together, these results suggest that HCA66 is a bona fide centrosomal protein. Deconvolution microscopy at high magnification revealed that centrosomal HCA66 in S phase is mainly concentrated in an area between the diplosomes, but not directly associated with the centrioles (Fig. 2D). Besides centrosomal staining, HCA66 also displays staining of the perichromosomal layer (Fig. 2B), an area where a subset of nucleolar proteins localizes during mitosis (van Hooser et al., 2005Go). Accordingly, HCA66 was detected in the proteome analysis of the chromosome scaffold (Gassmann et al., 2005Go).


Figure 2
View larger version (71K):
[in this window]
[in a new window]

 
Fig. 2. Centrosome localization of HCA66 is regulated during the cell cycle. (A) Immunofluorescence of HCA66 (green) in U-2 OS cells, synchronized in G1 (top) or S phase (bottom). Cells were co-stained with {gamma}-tubulin (red). Insets on the right are magnifications of the centrosomal areas (top inset, {gamma}-tubulin; middle, HCA66; bottom, merge). Arrowheads indicate the position of the centrosome. Histogram showing percentage of cells with HCA66 localizing to the centrosome, in G1 and S phase. (B) Immunofluorescence analysis of HCA66 localization at different stages of mitosis. Arrowheads indicate areas of perichromatin staining. HCA66 is in green, {gamma}-tubulin is in red, DNA is in blue. (C) Top: interphase cell treated with 5 µm nocodazole to depolymerize microtubules, stained for HCA66 (red) and {alpha}-tubulin (green). Bottom: mitotic cell treated with 5 µm taxol to induce non-centrosomal microtubule asters, stained for HCA66 (red) and {alpha}-tubulin (green). Arrowheads indicate the localization of centrosome-associated HCA66. The centrosomal identity was verified with the centriole marker centrin (data not shown). (D) Representative images showing localization of HCA66 relative to the centrioles. Panel showing immunofluorescence of four centrioles stained for centrin (red) and HCA66 (green). Top: maximum intensity projections of a stack of optical sections. The selected areas are shown at the bottom at higher magnification, in deconvolved optical sections taken at 0.2 µm z-steps. Scale bars: 10 µm.

 


Figure 3
View larger version (64K):
[in this window]
[in a new window]

 
Fig. 3. Identification of centrosomal and nucleolar targeting sequences of HCA66. (A) U-2 OS cells, transfected with different GFP:HCA66 constructs as indicated on the left, stained with antibody against {gamma}-tubulin (red). The cell transfected with GFP:HCA661-149 is shown at two different exposures of the GFP channel. Numbers in the GFP panels indicate the exposure time relative to GFP:HCA66. Arrowheads indicate the positions of the centrosomes. (B) U-2 OS cells overexpressing GFP:HCA661-86 (green), co-stained with antibodies against centrin (white) and against {gamma}-tubulin, GCP2, Nedd1 or endogenous HCA66 (red). Positions of centrioles co-localizing with GFP:HCA661-86 are indicated by arrowheads. Relative exposure times are indicated, as in A. Centrosomal HCA66 (c) and nucleolar HCA66 (nl) are recorded in two separate focal planes, in the cell depicted in the first row. Histogram, left: the percentage of interphase cells with centrosome staining of {gamma}-tubulin, GCP2 or Nedd1 is indicated, following overexpression of GFP, GFP:HCA66 or GFP:HCA661-86. Graph, right: the intensity of {gamma}-tubulin immunofluorescence at the centrosome is shown as a function of fluorescence levels of overexpressed GFP:HCA661-86 at the centrosome. (C) U-2 OS cells transfected with GFP, GFP:HCA66 or GFP:HCA661-86 (top). Microtubules were depolymerized in the cold for 2 hours and allowed to regrow for 2 minutes, before being fixed and processed for immunofluorescence of {alpha}-tubulin (bottom). The corresponding histogram indicates the percentage of cells with re-grown microtubule asters after 2, 3.5 and 5 minutes. Scale bars: 10 µm.

 
Mapping of centrosomal and nucleolar targeting domains of HCA66
To map domains of HCA66 that mediate centrosomal and nucleolar targeting, we generated deletion constructs tagged with GFP and examined their distribution in U-2 OS cells. GFP:HCA66151-597, which lacks the most conserved N-terminal region, displayed diffuse cytoplasmic and nuclear staining (Fig. 3A). To verify whether the N terminus of HCA66 is sufficient for centrosomal and nucleolar targeting, we generated GFP:HCA661-149. Consistently, GFP:HCA661-149 localized both to the nucleolus and the centrosome, although the centrosome staining appeared to be very weak (Fig. 3A). A smaller fusion protein encoded by GFP:HCA661-86 was absent from the nucleus, but colocalized with {gamma}-tubulin at the centrosome (Fig. 3A), indicating that the first 86 amino acids of HCA66 are sufficient to mediate centrosomal targeting. When expressed at low or moderate levels, GFP:HCA661-86 localized to the centrosome to a similar degree in G1- and S-phase-arrested cells (in 60% of cells blocked in G1 with 1 mM mimosine for 24 hours, or in 57% of cells released into S-phase from thymidine block, respectively). Moreover, GFP:HCA661-86 was found at the spindle poles in mitosis (Fig. 3A). This indicated that the centrosome localization of this HCA66 fragment is not cell cycle dependent. The cell cycle-dependent localization of endogenous, full-length HCA66 is thus probably regulated outside the region of amino acids 1 to 86.

In a following step, we wanted to test whether HCA66 binds to any previously characterized centrosome component. Efforts to identify HCA66 interactors by immunoprecipitation and biochemical methods were fruitless, due to the high insolubility of HCA66 and its deletion mutants throughout the cell cycle. We therefore investigated the effect of overexpression of full-length GFP:HCA66, GFP:HCA66151-597 and GFP:HCA661-86 on the localization of centrosomal proteins. Experiments with GFP, GFP-tagged full-length HCA66, or GFP:HCA66151-597 had no visible effect on centrin, PCM-1, or {gamma}-tubulin (Fig. 3A,B; supplementary material Fig. S2A). However, high overexpression of GFP:HCA661-86 led to reduced centrosomal localization of {gamma}-tubulin in 75% of asynchronous interphase cells, and induced the formation of cytoplasmic aggregates (Fig. 3B; supplementary material Fig. S2A). Closer inspection of cells synchronized either in G1 or in S-phase revealed that the numbers of cells lacking centrosomal {gamma}-tubulin was similar in both cases, 74% of cells in G1 and 68% of cells in S-phase, after high overexpression of GFP:HCA661-86. We found that increasing amounts of GFP:HCA661-86 at the centrosome lowered the immunofluorescence signal of {gamma}-tubulin at the centrosome below detection level (Fig. 3B, graph, right). The same HCA66 fragment also had a strong effect on the localization of the {gamma}-tubulin complex proteins GCP2 and NEDD1, and weaker effects on PCM-1 and centrin (Fig. 3B; supplementary material Fig. S2A). Consistent with loss of {gamma}-tubulin complex proteins from the centrosome, cells overexpressing GFP:HCA661-86 were defective in microtubule re-growth from a centrosomal organizing centre after cold-induced depolymerization (Fig. 3C). Whereas 88% of control cells expressing GFP, or 75% of cells expressing GFP-tagged full-length HCA66 re-grew microtubules within two minutes after recovery, only 35% of the cells expressing GFP:HCA661-86 were able to form microtubule asters during this time. Following prolonged incubation to five minutes, centrosomal microtubule asters grew in 46% of GFP:HCA661-86-expressing cells (Fig. 3C, graph). As a consequence of expressing high levels of GFP:HCA661-86 for two days, the cell cycle was affected, yielding only 7% of diploid cells in G1, 11% in S-phase, 20% in G2, and more than 50% aneuploid cells, as seen by flow cytometry (supplementary material Fig. S2B). Whereas mitotic figures were still visible in 0.5% of the cells after 12 hours, no mitotic cells could be identified any more by immunofluorescence from 24 hours onwards, suggesting that highly overexpressed GFP:HCA661-86 arrests the cell cycle. Immunoblot analysis of cells sorted for GFP fluorescence revealed that the amounts of {gamma}-tubulin were unchanged in cells transfected with GFP:HCA1-86 as compared to controls, indicating that the observed reduction of {gamma}-tubulin at the centrosome was due to displacement of the protein (supplementary material Fig. S2C). GFP:HCA661-86 did not displace endogenous HCA66 from the centrosome or from the nucleolus (Fig. 3B).

Depletion of HCA66 inhibits centriole duplication and leads to the formation of monopolar spindles
Because full-length HCA66 localizes to the centrosome in a cell cycle-dependent manner, we wanted to test whether HCA66 is involved in any aspect of centrosome function. For this reason, we performed RNA-silencing experiments using two different oligonucleotides against HCA66 (Fig. 4A). Treatment with the oligonucleotide HCA-4 allowed reproducible depletion of 75% or more of HCA66 protein after 48 hours, as determined by serial dilution and blot densitometry (data not shown). Silencing of HCA66 inhibited the duplication of centrioles, as two or less centrin signals were seen in 50% of the depleted cells during mitosis (n=80) (Fig. 4B, graph), in contrast to controls that showed four centrioles in 70% of all mitotic cells. Consistently, silenced U-2 OS cells that were arrested with hydroxyurea failed to re-duplicate centrioles efficiently (38% of the treated cells), whereas 69% of control cells showed four or more centrioles (Fig. 4C). Overexpression of GFP-tagged full-length HCA66, however, did not alter centriole numbers. Cells lacking HCA66 showed aberrant microtubule organization in mitosis, mostly in the form of monopolar spindles, and failure of chromosome alignment (Fig. 4D). Chromatin condensation and immunolabelling of phosphorylated histone H3 suggested that these cells were in prometaphase (data not shown).


Figure 4
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 4. HCA66 depletion leads to mitotic defects. (A) Immunoblots, probed with anti-HCA66, of U-2 OS cells treated with siRNA against HCA66 using two different oligonucleotides, HCA-2 and HCA-4, or control siRNA (C). {alpha}-Tubulin is shown as a loading control. (B) U-2 OS cells were transfected with HCA-4 oligonucleotides or control siRNA, and processed after 48 hours for immunofluorescence of HCA66 (green) and centrin to indicate the number of centrioles (insets show magnified areas of centrin staining). Mitotic cells are shown for both control and HCA66 siRNA. DNA is shown in blue. Histogram depicts the percentage of mitotic cells containing 0-1, 2, 3, 4, 5 or more centrioles per cells. Black columns, control cells; white columns, cells treated with HCA66 siRNA. (C) Control and HCA66-depleted U-2 OS cells treated with hydroxyurea (HU) to induce overduplication of centrioles. Graph depicts the percentage of cells containing ≤4 or >4 centrioles/cell. (D) Immunofluorescence of U-2 OS cells treated as in B. HCA66 is shown in green, {alpha}-tubulin in red and DNA in blue. One control cell in metaphase and three depleted cells in mitosis are shown. Histogram depicts the percentage of mitotic cells after control treatment or HCA66 siRNA, containing monopolar spindles (grey) or spindles with poorly separated poles (white). (E) Left panel: mitotic index of cells 48 hours after siRNA (control or HCA66). Mean from three experiments, error bars indicate s.d., ~500 cells were scored per condition. Right panel: frequency of different mitotic stages after 48 hours of HCA66 siRNA treatment (mean from three experiments, error bars indicate s.d., ~200 cells were scored per condition). (F) Percentage of cells with micronuclei after control and HCA66 siRNA for 48 hours (mean from three experiments, error bars indicate s.d., ~500 cells were scored per condition). (G) Growth curve of control-depleted cells and HCA66-depleted cells. Scale bars: 10 µm.

 
Depletion of HCA66 led to an increase of mitotic figures after 48 hours, from ~5% in controls to ~13.4% in depleted cells, suggesting a delay in mitosis (Fig. 4E). Further analysis showed that 80% of the mitotic cells were accumulating in prometaphase, compared with ~55% of mitotic cells in controls (Fig. 4E), with the vast majority containing monopolar spindles. We also observed an increased number of cells with micronuclei upon HCA66 siRNA treatment (31%, compared with 12% in controls) (Fig. 4F), suggesting that depletion of HCA66 led to chromosome segregation defects. Prolonged siRNA treatment up to 96 hours significantly reduced the number of cells (Fig. 4G) and led to an almost complete disappearance of mitotic figures (<0.7%), indicating that HCA66 is essential for viability.

Depletion of HCA66 leads to reduction of {gamma}-TuSC protein levels
The defects that we observed upon siRNA treatment against HCA66, e.g. monopolar spindle formation or failure of centriole duplication, were reminiscent of the defects obtained from {gamma}-tubulin depletion (Sunkel et al., 1995Go; Strome et al., 2001Go; Hannak et al., 2002Go; Dammermann et al., 2004Go; Haren et al., 2006Go). As overexpression of GFP:HCA661-86 affects centrosomal {gamma}-tubulin (Fig. 3B), we decided to investigate the behaviour of proteins of the {gamma}-TuRC in cells treated with HCA66 siRNA. In interphase, {gamma}-tubulin at the centrosome was reduced to 45% of the respective control levels (Fig. 5A,B). In mitotic control cells, {gamma}-tubulin at the centrosome increased fourfold compared with interphase, in good agreement with findings by Khodjakov and Rieder (Khodjakov and Rieder, 1999Go). However, in HCA66-depleted mitotic cells, centrosome-bound {gamma}-tubulin was drastically reduced to 7% of mitotic control levels (Fig. 5A,B), implying that HCA66 activity might be particularly important during centrosome maturation. Although the formation of centrosomal microtubule asters after depolymerization and regrowth was delayed in HCA66-depleted cells (supplementary material Fig. S3A), photometric analysis of interphase and mitotic cells revealed that the overall amount of microtubule polymer was not significantly affected prior to depolymerization (Fig. 5C). Thus, the reduction of {gamma}-tubulin at the centrosome after HCA66 depletion does not significantly alter steady state levels of microtubule polymer in our cells. This is consistent with Strome et al. (Strome et al., 2001Go) and Hannak et al. (Hannak et al., 2002Go), who showed that microtubules can form despite depletion of {gamma}-tubulin, although their nucleation from the centrosome is kinetically disadvantaged. In addition to {gamma}-tubulin, the immunofluorescence signals of GCP2, GCP4 and Nedd1/GCP-WD at the centrosome were reduced after HCA66 siRNA (Fig. 5A,B). Other proteins of the centrosome and of the spindle pole such as pericentrin, centrin, TPX2, Aurora A or Plk1 were not significantly affected (Fig. 5A,B; supplementary material Fig. S3B), suggesting that HCA66 siRNA affects specifically the centrosomal localization of {gamma}-TuRC proteins.


Figure 5
View larger version (62K):
[in this window]
[in a new window]

 
Fig. 5. Depletion of HCA66 reduces pericentriolar localization of {gamma}-TuRC proteins. (A) U-2 OS cells were transfected with HCA66 siRNA or control siRNA, and processed after 48 hours for immunofluorescence of HCA66, {gamma}-tubulin, centrin, GCP2, GCP4, Nedd1, Aurora A and pericentrin, as indicated. Top panels left show interphase cells, the remaining panels show mitotic cells. Arrowheads indicate the positions of the centrosomes. (B) Histogram depicting the relative intensity of immunofluorescence at the mitotic centrosome, of proteins shown in A. Standard deviations are shown for both controls (black columns) and cells treated with HCA66 siRNA (white columns, n≥35). {gamma}-Tubulin immunofluorescence was measured both in mitosis and in interphase (n=85); in the graphs, the average immunofluorescence intensity in mitosis is defined as 100% and used as a reference for interphase. (C) The immunofluorescence intensity of polymerized microtubules is quantified in interphase and mitosis (n=25). The signal in mitotic control cells is set at 100%. Labelling as in B. Scale bar: 10 µm.

 

Subsequently, immunoblot analysis was performed to distinguish between problems of centrosomal recruitment of these proteins and reduction in protein amounts. Fig. 6 shows that depletion of HCA66 led to a decrease of the protein levels of {gamma}-tubulin, GCP2 and GCP3. These three proteins are known to form the {gamma}-TuSC. HCA66 and the {gamma}-TuSC protein levels were reduced to a comparable degree after HCA66 siRNA, to around 30 to 40% of control levels (graph, Fig. 6). Moreover, the levels of GCP2 were also reduced following depletion of {gamma}-tubulin, suggesting that the expression of {gamma}-TuSC components is interdependent (Fig. 6). By contrast, silencing of {gamma}-tubulin did not reciprocally affect the levels of HCA66. Experiments involving reverse transcription of RNA, followed by PCR for {gamma}-tubulin, GCP2 and GCP3 showed that transcription of {gamma}-TuSC genes was unaffected by HCA66 silencing, indicating that HCA66 is involved in regulating the protein levels but not the mRNA of {gamma}-TuSC components (supplementary material Fig. S3C). Whereas silencing of HCA66 diminished the amounts of all {gamma}-TuSC components, protein levels of {gamma}-TuRC-specific components such as GCP4 or Nedd1/GCP-WD, or of the pericentriolar protein PCM-1 were not reduced. Moreover, the levels of the kinases Aurora A and Plk1 also remained constant (Fig. 6). Because Aurora A and Plk1 still localize to the centrosome in the absence of HCA66 (Fig. 5; supplementary material Fig. S3B), we conclude that HCA66 is not involved in regulating the expression, the stability or the recruitment to the centrosome of these mitotic kinases.


Figure 6
View larger version (45K):
[in this window]
[in a new window]

 
Fig. 6. Depletion of HCA66 reduces {gamma}-TuSC protein levels. U-2 OS cells were transfected with `HCA-4' siRNA oligonucleotides against HCA66 or with control siRNA (C). Whole-cell lysates were analyzed by immunoblotting with anti-HCA66, anti-{gamma}-tubulin, anti-GCP2, anti-GCP3, anti-GCP4, anti-Aurora A, anti-Plk1, anti-Nedd1, anti-PCM-1 and anti-{alpha}-tubulin antibodies. Furthermore, immunoblot of cells treated with siRNA against {gamma}-tubulin, probed with antibodies against {gamma}-tubulin, GCP2, actin, CPAP and HCA66 are shown. Histogram indicating the signal intensities of western blots of HCA66, {gamma}-tubulin, GCP2 and GCP3 from HCA66-depleted cells. The mean values from four different experiments and standard deviations are shown. The percentages are expressed in relation to the respective control levels of each protein (=100%). The calculation of all values was performed after normalization over {alpha}-tubulin levels, to correct for uneven loading.

 
Because HCA66 showed similarities to the yeast pre-ribosome assembly factor Utp6p, and because depletion of HCA66 reduced the levels of {gamma}-TuSC proteins, we reasoned that translation of their mRNA might have been inhibited. Alternatively, we reasoned that the {gamma}-TuSC proteins might be more susceptible to degradation in the absence of HCA66. To test these ideas, we compared the effects of the translation inhibitor cycloheximide and of the proteasome inhibitor MG132 with the phenotypes obtained after silencing of HCA66. We noticed that the phenotypes produced by these two drugs differed from the effects of HCA66 siRNA: more than 90% of the cells treated with either inhibitor still contained {gamma}-tubulin at the centrosome after 2 days, and we failed to observe any accumulation of monopolar spindles in these treated cells (supplementary material Fig. S3D). We therefore conclude that the phenotype of HCA66 depletion is neither due to a general block of translation, nor due to an unspecific inhibition of proteasome-dependent degradation.


    Discussion
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
We characterize HCA66 as a novel component of the nucleolus that localizes to the centrosome in a cell cycle-dependent manner. We demonstrate that HCA66 is necessary for centriole duplication and bipolar spindle assembly. Furthermore, we show that HCA66 plays a role in regulating the protein levels of the {gamma}-TuSC components {gamma}-tubulin, GCP2 and GCP3. By contrast, HCA66-depletion does not affect the protein levels of {gamma}-TuRC-specific proteins such as GCP4 or GCP-WD/NEDD1. Nevertheless, these proteins are found less concentrated at centrosomes in mitosis, potentially because their proper recruitment to the pericentriolar material requires fully assembled {gamma}-TuRCs and thus depends on the presence of {gamma}-TuSCs (Raynaud-Messina and Merdes, 2007Go). Even though HCA66 is necessary for {gamma}-tubulin localization to the centrosome both in interphase and mitosis, depletion of HCA66 affects centrosomal amounts of {gamma}-tubulin most drastically in mitosis. This correlates with the cell cycle-specific localization of HCA66, which binds to the centrosome only between S-phase and metaphase of mitosis, raising the possibility that HCA66 regulates {gamma}-tubulin complex proteins while centrosome bound.

Because failure in centriole duplication has previously been described to result from the depletion of {gamma}-tubulin (Dammermann et al., 2004Go; Haren et al., 2006Go), we think that the centriole defects seen after removal of HCA66 are probably due to the loss of {gamma}-tubulin. Likewise, monopolar spindle formation in HCA66-depleted cells can be explained by the loss of functional {gamma}-tubulin or {gamma}-TuSCs, as seen in knock-down experiments or mutants in various species (Sunkel et al., 1995Go; Barbosa et al., 2000Go; Strome et al., 2001Go; Hannak et al., 2002Go; Barbosa et al., 2003Go; Raynaud-Messina et al., 2004Go; Yuba-Kubo et al., 2005Go; Colombié et al., 2006Go; Haren et al., 2006Go). It is likely that the spindle defects in HCA66-depleted cells lead to chromosome segregation defects and micronuclei, explaining the increased cell death observed in HCA66-depleted cultures, but we cannot exclude the possibility that HCA66 plays additional roles in interphase that are important for the survival of the cells.

So far, the significance of the nucleolar localization of HCA66 during interphase remains unclear. Interestingly, several other nucleolar proteins have been described that also fulfil roles at the mitotic spindle or at the centrosome, such as NuSAP and nucleophosmin. NuSAP localizes to the spindle during mitosis and crosslinks microtubules (Raemaekers et al., 2003Go; Ribbeck et al., 2006Go). Nucleophosmin binds to the centrosome and is implicated in controlling centriole duplication (Okuda et al., 2000Go). In addition, nucleophosmin participates in ribosome biogenesis (Frehlick et al., 2007Go). At the molecular level, nucleophosmin acts as a chaperone, potentially preventing protein aggregation in the nucleolus and assisting nucleo-cytoplasmic shuttling and protein assembly (Szebeni and Olson, 1999Go; Yu et al., 2006Go). Likewise, HCA66 may play a dual role at the centrosome and in ribosome assembly, similar to nucleophosmin. This would be consistent with our finding that HCA66 shows homology with the budding yeast protein Utp6p, a protein that is part of the 90S pre-ribosomal particle (Dragon et al., 2002Go; Dosil and Bustelo, 2004Go). Depending on the cell cycle, HCA66 may associate with various protein complexes, such as pre-ribosomal particles or {gamma}-TuSCs. Our data indicate that overexpression of the N-terminal region comprising amino acids 1 to 86 of HCA66 displaces {gamma}-tubulin from the centrosome, arguing for an interaction between HCA66 and {gamma}-tubulin. Because overexpression of this N-terminal fragment does not displace endogenous HCA66 and does not alter {gamma}-tubulin protein levels, this fragment probably exerts a dominant effect on centrosome integrity. Morover, this HCA66 fragment binds to the centrosome in a constitutive manner throughout the cell cycle, whereas the full-length, endogenous HCA66 protein only accumulates at the centrosome between S-phase and mitosis. This suggests that the localization of HCA66 to the centrosome is regulated outside its N-terminal region, and that the overexpressed short fragment of amino acids 1 to 86 behaves abnormally. Yeast two-hybrid and biochemical assays failed to reveal binding of HCA66 to {gamma}-TuSC proteins (data not shown), leading us to conclude that HCA66 and {gamma}-tubulin may interact indirectly, or in a regulated, transient manner that is not reproduced in vitro. When trying to identify binding partners of HCA66 in biochemical and immunoprecipitation assays, we noticed that HCA66 was highly insoluble. This complicated further investigation of regulated transient interactions or low-affinity interactions with potential binding partners.

We speculate that a possible mechanism by which the {gamma}-TuSC proteins might be regulated may include a chaperone activity by HCA66, analogous to nucleophosmin function. Because no direct binding of HCA66 to {gamma}-TuSC proteins was seen, such an activity might involve additional partner proteins. HCA66 could either protect the entity of the {gamma}-TuSC, or protect individual {gamma}-TuSC components before assembly. Loss of individual {gamma}-TuSC proteins might affect the translation of their partners via feedback or, alternatively, monomeric {gamma}-complex proteins that fail to assemble into {gamma}-TuSCs might be degraded more rapidly than the assembled ones. These two scenarios would explain the specific loss of all {gamma}-TuSC proteins after silencing of HCA66 expression, and they explain our observation of reduced GCP2 levels in cells in which {gamma}-tubulin was silenced. Other chaperone proteins are known that interact with {gamma}-tubulin and bind to the centrosome, including TCP1, UXT and co-factor D (Melki et al., 1993Go; Zhao et al., 2005Go; Cunningham and Kahn, 2008Go). Interestingly, co-factor D contains a series of HEAT sequence repeats, reminiscent of the HAT repeats found in HCA66, and silencing also results in spindle pole defects (Cunningham and Kahn, 2008Go). However, silencing of co-factor D does not alter {gamma}-TuSC protein levels.

We propose that HCA66-dependent stability of {gamma}-TuSC proteins represents a novel element of the complex regulatory machinery that controls microtubule nucleation, centrosome duplication and mitotic spindle assembly. In the future, more knowledge on the potential interactors of HCA66 will be needed to understand the exact molecular mechanisms.


    Materials and Methods
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 
Cloning procedures
HCA66 cDNA was generated by reverse transcription of RNA isolated from Jurkat cells. Full-length clones were prepared by PCR, using KOD DNA polymerase (Novagen) and primers CCGGGGTACCATGGCAGAGATAATTCCAGGA (HCA66fwd) and CGCGGATCCTAAATGGCCAGTCTGATGCA (HCA66rev). pRSET-HCA6687-366 was generated by cutting full-length HCA66 with EcoRI and HindIII, and cloning it into pRSET-C (Invitrogen). GFP:HCA66 was generated by cloning full-length HCA66 into KpnI and BamHI sites of pEGFP-C1 (Clontech). GFP:HCA661-86 and GFP:HCA661-149 were generated by PCR using HCA66fwd with AAACTGCAGTCAATTCTCTCAATCTCATCCTTCTT or AAACTGCAGTTGGCTGCCATAATCCACAA, respectively. The PCR products were cloned into KpnI and XhoI sites of pEGFP-C1. GFP:HCA66151-597 was generated by PCR using primers AGAATTCAATGGAAGATCGATTGTCTTC and HCA66rev. The PCR product was cloned into EcoRI and BamHI sites of pEGFP-C1.

Antibodies
6xHis-HCA6687-366 fusion protein was expressed in E. coli and affinity purified on nickel agarose beads under denaturing conditions. The eluted protein was used for antibody production in rabbits. Other primary antibodies used in this study were: mouse anti-alpha-tubulin (DM1A, Sigma-Aldrich), anti-{gamma}-tubulin (mouse GTU-88 or rabbit AK-15, Sigma-Aldrich), mouse anti-actin MAB1501 (Chemicon), mouse anti-pericentrin, rabbit anti-PCM-1 (Dammermann and Merdes, 2002Go), mouse anti-centrin 20H5 (gift from Dr J. Salisbury, Mayo Clinic, Rochester, MN), rabbit anti-GCP2 (gift from Dr T. Stearns, Berkley, CA), rabbit anti-GCP4 (Fava et al., 1999Go), rabbit anti-GCP3 (gift from Dr M. Bornens, Paris, France), rabbit anti-Nedd1 (Haren et al., 2006Go) and rabbit anti-CPAP (against a bacterially expressed, GST-tagged human CPAP fragment containing amino acids 1 to 295).

Cell culture experiments
U-2 OS cells were cultured in Dulbecco's modified Eagle's medium. Jurkat cells were cultured in RPMI 1640. All media were supplemented with 10% foetal calf serum, 2 mM L-glutamine, 50 IU penicillin and streptomycin. For immunofluorescence experiments, cells were synchronized by mitotic shake-off and replated for further 2 hours to enter G1 phase. Cells in S-phase were synchronized by a double thymidine block and released for 3 hours, before addition of BrdU. Synchronization was verified by immunofluorescence of BrdU (rat anti BrdU, Harlan Scientific), indicating 17.5±2.5% of BrdU-positive cells in G1 populations versus 83.8±5.0% in S-phase populations. For centrosome purification, cells were arrested in S-phase using a double aphidicolin block: 1 µg/ml of aphidicolin was added to the culture medium for 16 hours, washed off and the cells were grown for 9 hours under normal conditions. A second block was then performed for another 16 hours. The percentage of cells in S phase was determined by flow cytometry. For this, cells were washed in cold PBS and fixed in cold 70% ethanol. Cells were then washed and incubated for 30 minutes at 37°C with RNase A (10 µg/ml). Propidium iodide (40 µg/ml) was added to the cells before analysis with a FACSCalibur instrument and CellQuest software (Becton Dickinson). To assay for centriole overduplication, U-2 OS cells were treated first for 12 hours with HCA66 siRNA or control RNA, then 2 mM hydroxyurea was added and incubation continued for additional 40 hours.

Transfection procedures
GFP constructs were transfected using FuGene-6 (Roche) according to the manufacturer's instructions. Cells were fixed 48 hours after transfection. Double-stranded siRNA oligomers were transfected into U-2 OS cells using a Nucleofector apparatus, program U-24 and nucleofection solution V (Amaxa), according to the manufacturer's instructions. Two siRNAs targeting HCA66 mRNA were used (Xeragon). Results presented here correspond to the targeting of nucleotides 421-432 (HCA-4; CCAGCUUUGUGGAUUAUGGdTdT). Targeting of nucleotides 965-983 (HCA-2; CAGAGGCCAUGUGGAAGUGdTdT) induced similar depletion levels and cellular phenotypes. Control depletion was carried out using oligomers targeting Luciferase. Depletion of {gamma}-tubulin was performed as described (Haren et al., 2006Go).

Microtubule regrowth assay
Cells grown on glass coverslips were transferred into pre-cooled medium on ice, then into pre-warmed medium at 37°C. Regrowth was stopped by methanol fixation.

Immunoblotting and indirect immunofluorescence
Gel electrophoresis and immunobloting were performed using standard protocols. Serum against HCA66 was used at 1:1000 dilution. For immunofluorescence, cells were grown on glass coverslips, fixed with methanol at –20°C, and processed using standard protocols.

The content of microtubule polymer in cells was determined by adapting a protocol of Zhai et al. (Zhai et al., 1996Go). Briefly, cells were pre-extracted with 0.2% Triton X-100 in PHEM (60 mM PIPES, 25 mM HEPES, 1 mM EGTA, 2 mM MgCl2) at 37°C. Subsequently, cells were fixed with 4% formaldehyde in the same buffer supplemented with 1 µM taxol, and stained for immunofluorescence of {alpha}-tubulin. The amount of microtubule fluorescence was quantified in the whole cell after background subtraction. Images were acquired with an Axiocam camera on an Axioskop 2 microscope (Carl Zeiss) using a 100x NA 1.30 objective, or with a COOLSNAP HQ ICX285 camera (Roper Scientific) on an OLYMPUS IX-70 microscope controlled by DeltaVision Softworx (Applied Precision), using a 100x NA 1.40 objective. After deconvolution, image files were projected using the maximum intensity function. Image processing was carried out using Photoshop (Adobe).

Purification of centrosomes
Centrosomes were purified from Jurkat cells as described previously (Bornens et al., 1987Go). Centrosome fractions were assayed for their ability to stimulate aster formation, by incubation with concentrated mitotic frog egg extract or with pure porcine brain tubulin. In both cases, rhodamine-labelled tubulin was added to visualize microtubules by fluorescence microscopy. Purified centrosomes were incubated in 1 M KI at 4°C in the dark, then centrifuged at 120,000 g for 30 minutes at 4°C. The KI-soluble material was then concentrated and filtered using a Centricon YM-10 (Millipore) device. The retained proteins were recovered, boiled for 5 minutes in protein sample buffer and stored at –80°C until loading onto 7.5% Tris-glycine polyacrylamide gels. Protein bands were visualized by silver staining. Individual bands were cut and digested with Trypsin (Promega) (Shevchenko et al., 1996Go). The MALDI-tof mass spectra were acquired on a PerSeptive Biosystems Voyager DE STR instrument (Applied Biosystems) and analyzed using MS-Fit tool (http://prospector.ucsf.edu/ucsfhtml4.0/msfit.htm).


    Footnotes
 
Supplementary material available online at http://jcs.biologists.org/cgi/content/full/122/8/1134/DC1

We are grateful to Drs V. Srsen, W. C. Earnshaw, K. Sawin and E. Schirmer (Edinburgh), for stimulating discussions and for sharing equipment, and to Drs M. Bornens (Paris), J. Salisbury (Rochester) and T. Stearns (Stanford) for the gift of reagents. The work was supported by a Senior Research Fellowship from the Wellcome Trust, by the CNRS, and by the Pierre Fabre Group. X.F. was supported by a Wellcome Trust Prize Fellowship. Deposited in PMC for release after 6 months.


    References
 Top
 Summary
 Introduction
 Results
 Discussion
 Materials and Methods
 References
 

Andersen, J. S., Lam, Y. W., Leung, A. K., Ong, S. E., Lyon, C. E., Lamond, A. I. and Mann, M. (2005). Nucleolar proteome dynamics. Nature 433, 77-83.[CrossRef][Medline]

Barbosa, V., Yamamoto, R. R., Henderson, D. S. and Glover, D. M. (2000). Mutation of a Drosophila gamma tubulin ring complex subunit encoded by discs degenerate-4 differentially disrupts centrosomal protein localization. Genes Dev. 14, 3126-3139.[Abstract/Free Full Text]

Barbosa, V., Gatt, M., Rebollo, E., Gonzalez, C. and Glover, D. M. (2003). Drosophila dd4 mutants reveal that gammaTuRC is required to maintain juxtaposed half spindles in spermatocytes. J. Cell Sci. 116, 929-941.[Abstract/Free Full Text]

Berdnik, D. and Knoblich, J. A. (2002). Drosophila Aurora-A is required for centrosome maturation and actin-dependent asymmetric protein localization during mitosis. Curr. Biol. 12, 640-647.[CrossRef][Medline]

Bornens, M., Paintrand, M., Berges, J., Marty, M. C. and Karsenti, E. (1987). Structural and chemical characterization of isolated centrosomes. Cell Motil. Cytoskeleton 8, 238-249.[CrossRef][Medline]

Casenghi, M., Meraldi, P., Weinhart, U., Duncan, P. I., Korner, R. and Nigg, E. A. (2003). Polo-like kinase 1 regulates Nlp, a centrosome protein involved in microtubule nucleation. Dev. Cell 5, 113-125.[CrossRef][Medline]

Chen, C. H., Howng, S. L., Cheng, T. S., Chou, M. H., Huang, C. Y. and Hong, Y. R. (2003). Molecular characterization of human ninein protein: two distinct subdomains required for centrosomal targeting and regulating signals in cell cycle. Biochem. Biophys. Res. Commun. 308, 975-983.[CrossRef][Medline]

Colombié, N., Vérollet, C., Sampaio, P., Moisand, A., Sunkel, C., Bourbon, H. M., Wright, M. and Raynaud-Messina, B. (2006). The Drosophila gamma-tubulin small complex subunit Dgrip84 is required for structural and functional integrity of the spindle apparatus. Mol. Biol. Cell 17, 272-282.[Abstract/Free Full Text]

Cunningham, L. A. and Kahn, R. A. (2008). Cofactor D functions as a centrosomal protein and is required for the recruitment of the gamma-tubulin ring complex at centrosomes and organization of the mitotic spindle. J. Biol. Chem. 283, 7155-7165.[Abstract/Free Full Text]

Dammermann, A. and Merdes, A. (2002). Assembly of centrosomal proteins and microtubule organization depends on PCM-1. J. Cell Biol. 159, 255-266.[Abstract/Free Full Text]

Dammermann, A., Müller-Reichert, T., Pelletier, L., Habermann, B., Desai, A. and Oegema, K. (2004). Centriole assembly requires both centriolar and pericentriolar material proteins. Dev. Cell 7, 815-829.[CrossRef][Medline]

Delgehyr, N., Sillibourne, J. and Bornens, M. (2005). Microtubule nucleation and anchoring at the centrosome are independent processes linked by ninein function. J. Cell Sci. 118, 1565-1575.[Abstract/Free Full Text]

Dosil, M. and Bustelo, X. R. (2004). Functional characterization of Pwp2, a WD family protein essential for the assembly of the 90 S pre-ribosomal particle. J. Biol. Chem. 279, 37385-37397.[Abstract/Free Full Text]

Dragon, F., Gallagher, J. E., Compagnone-Post, P. A., Mitchell, B. M., Porwancher, K. A., Wehner, K. A., Wormsley, S., Settlage, R. E., Shabanowitz, J., Osheim, Y. et al. (2002). A large nucleolar U3 ribonucleoprotein required for 18S ribosomal RNA biogenesis. Nature 417, 967-970.[CrossRef][Medline]

Fava, F., Raynaud-Messina, B., Leung-Tack, J., Mazzolini, L., Li, M., Guillemot, J. C., Cachot, D., Tollon, Y., Ferrara, P. and Wright, M. (1999). Human 76p: A new member of the gamma-tubulin-associated protein family. J. Cell Biol. 147, 857-868.[Abstract/Free Full Text]

Frehlick, L. J., Eirín-López, J. M. and Ausió, J. (2007). New insights into the nucleophosmin/nucleoplasmin family of nuclear chaperones. BioEssays 29, 49-59.[CrossRef][Medline]

Gassmann, R., Henzing, A. J. and Earnshaw, W. C. (2005). Novel components of human mitotic chromosomes identified by proteomic analysis of the chromosome scaffold fraction. Chromosoma 113, 385-397.[CrossRef][Medline]

Hannak, E., Kirkham, M., Hyman, A. A. and Oegema, K. (2001). Aurora-A kinase is required for centrosome maturation in Caenorhabditis elegans. J. Cell Biol. 155, 1109-1116.[Abstract/Free Full Text]

Hannak, E., Oegema, K., Kirkham, M., Gonczy, P., Habermann, B. and Hyman, A. A. (2002). The kinetically dominant assembly pathway for centrosomal asters in Caenorhabditis elegans is gamma-tubulin dependent. J. Cell Biol. 157, 591-602.[Abstract/Free Full Text]

Haren, L., Remy, M. H., Bazin, I., Callebaut, I., Wright, M. and Merdes, A. (2006). NEDD1-dependent recruitment of the gamma-tubulin ring complex to the centrosome is necessary for centriole duplication and spindle assembly. J. Cell Biol. 172, 505-515.[Abstract/Free Full Text]

Khodjakov, A. and Rieder, C. L. (1999). The sudden recruitment of gamma-tubulin to the centrosome at the onset of mitosis and its dynamic exchange throughout the cell cycle, do not require microtubules. J. Cell Biol. 146, 585-596.[Abstract/Free Full Text]

Lajoie-Mazenc, I., Tollon, Y., Detraves, C., Julian, M., Moisand, A., Gueth-Hallonet, C., Debec, A., Salles-Passador, I., Puget, A., Mazarguil, H. et al. (1994). Recruitment of antigenic gamma-tubulin during mitosis in animal cells: presence of gamma-tubulin in the mitotic spindle. J. Cell Sci. 107, 2825-2837.[Abstract]

Lane, H. A. and Nigg, E. A. (1996). Antibody microinjection reveals an essential role for human polo-like kinase 1 (Plk1) in the functional maturation of mitotic centrosomes. J. Cell Biol. 135, 1701-1713.[Abstract/Free Full Text]

Lüders, J., Patel, U. K. and Stearns, T. (2006). GCP-WD is a gamma-tubulin targeting factor required for centrosomal and chromatin-mediated microtubule nucleation. Nat. Cell Biol. 8, 137-147.[CrossRef][Medline]

Melki, R., Vainberg, I. E., Chow, R. L. and Cowan, N. J. (1993). Chaperonin-mediated folding of vertebrate actin-related protein and gamma-tubulin. J. Cell Biol. 122, 1301-1310.[Abstract/Free Full Text]

Oegema, K., Wiese, C., Martin, O. C., Milligan, R. A., Iwamatsu, A., Mitchison, T. J. and Zheng, Y. (1999). Characterization of two related Drosophila gamma-tubulin complexes that differ in their ability to nucleate microtubules. J. Cell Biol. 144, 721-733.[Abstract/Free Full Text]

Okuda, M., Horn, H. F., Tarapore, P., Tokuyama, Y., Smulian, A. G., Chan, P. K., Knudsen, E. S., Hofmann, I. A., Snyder, J. D., Bove, K. E. et al. (2000). Nucleophosmin/B23 is a target of CDK2/cyclin E in centrosome duplication. Cell 103, 127-140.[CrossRef][Medline]

Piddubnyak, V., Rigou, P., Michel, L., Rain, J. C., Geneste, O., Wolkenstein, P., Vidaud, D., Hickman, J. A., Mauviel, A. and Poyet, J. L. (2007). Positive regulation of apoptosis by HCA66, a new Apaf-1 interacting protein, and its putative role in the physiopathology of NF1 microdeletion syndrome patients. Cell Death Differ. 14, 1222-1233.[CrossRef][Medline]

Preker, P. J. and Keller, W. (1998). The HAT helix, a repetitive motif implicated in RNA processing. Trends Biochem. Sci. 23, 15-16.[CrossRef][Medline]

Raemaekers, T., Ribbeck, K., Beaudouin, J., Annaert, W., Van Camp, M., Stockmans, I., Smets, N., Bouillon, R., Ellenberg, J. and Carmeliet, G. (2003). NuSAP, a novel microtubule-associated protein involved in mitotic spindle organization. J. Cell Biol. 162, 1017-1029.[Abstract/Free Full Text]

Raynaud-Messina, B. and Merdes, A. (2007). Gamma-tubulin complexes and microtubule organization. Curr. Opin. Cell Biol. 19, 24-30.[CrossRef][Medline]

Raynaud-Messina, B., Mazzolini, L., Moisand, A., Cirinesi, A. M. and Wright, M. (2004). Elongation of centriolar microtubule triplets contributes to the formation of the mitotic spindle in gamma-tubulin-depleted cells. J. Cell Sci. 117, 5497-5507.[Abstract/Free Full Text]

Ribbeck, K., Groen, A. C., Santarella, R., Bohnsack, M. T., Raemaekers, T., Köcher, T., Gentzel, M., Görlich, D., Wilm, M., Carmeliet, G. et al. (2006). NuSAP, a mitotic RanGTP target that stabilizes and cross-links microtubules. Mol. Biol. Cell 17, 2646-2660.[Abstract/Free Full Text]

Shevchenko, A., Wilm, M., Vorm, O. and Mann, M. (1996). Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68, 850-858.[Medline]

Strome, S., Powers, J., Dunn, M., Reese, K., Malone, C. J., White, J., Seydoux, G. and Saxton, W. (2001). Spindle dynamics and the role of gamma-tubulin in early Caenorhabditis elegans embryos. Mol. Biol. Cell 12, 1751-1764.[Abstract/Free Full Text]

Sunkel, C. E., Gomes, R., Sampaio, P., Perdigão, J. and González, C. (1995). Gamma-tubulin is required for the structure and function of the microtubule organizing centre in Drosophila neuroblasts. EMBO J. 14, 28-36.[Medline]

Szebeni, A. and Olson, M. O. (1999). Nucleolar protein B23 has molecular chaperone activities. Protein Sci. 8, 905-912.[Medline]

Takahashi, M., Yamagiwa, A., Nishimura, T., Mukai, H. and Ono, Y. (2002). Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol. Biol. Cell 13, 3235-3245.[Abstract/Free Full Text]

Terada, Y., Uetake, Y. and Kuriyama, R. (2003). Interaction of Aurora-A and centrosomin at the microtubule-nucleating site in Drosophila and mammalian cells. J. Cell Biol. 162, 757-763.[Abstract/Free Full Text]

Van Hooser, A. A., Yuh, P. and Heald, R. (2005). The perichromosomal layer. Chromosoma 114, 377-388.[CrossRef][Medline]

Wang, Y., Han, K. J., Pang, X. W., Vaughan, H. A., Qu, W., Dong, X. Y., Peng, J. R., Zhao, H. T., Rui, J. A., Leng, X. S. et al. (2002). Large scale identification of human hepatocellular carcinoma-associated antigens by autoantibodies. J. Immunol. 169, 1102-1109.[Abstract/Free Full Text]

Yu, Y., Maggi, L. B., Jr, Brady, S. N., Apicelli, A. J., Dai, M. S., Lu, H. and Weber, J. D. (2006). Nucleophosmin is essential for ribosomal protein L5 nuclear export. Mol. Cell. Biol. 26, 3798-3809.[Abstract/Free Full Text]

Yuba-Kubo, A., Kubo, A., Hata, M. and Tsukita, S. (2005). Gene knockout analysis of two gamma-tubulin isoforms in mice. Dev. Biol. 282, 361-373.[CrossRef][Medline]

Zhai, Y., Kronebusch, P. J., Simon, P. M. and Borisy, G. G. (1996). Microtubule dynamics at the G2/M transition: abrupt breakdown of cytoplasmic microtubules at nuclear envelope breakdown and implications for spindle morphogenesis. J. Cell Biol. 135, 201-214.[Abstract/Free Full Text]

Zhao, H., Wang, Q., Zhang, H., Liu, Q., Du, X., Richter, M. and Greene, M. I. (2005). UXT is a novel centrosomal protein essential for cell viability. Mol. Biol. Cell 16, 5857-5865.[Abstract/Free Full Text]

Zheng, Y., Jung, M. K. and Oakley, B. R. (1991). Gamma-tubulin is present in Drosophila melanogaster and Homo sapiens and is associated with the centrosome. Cell 65, 817-823.[CrossRef][Medline]

Zimmerman, W. C., Sillibourne, J., Rosa, J. and Doxsey, S. J. (2004). Mitosis-specific anchoring of gamma tubulin complexes by pericentrin controls spindle organization and mitotic entry. Mol. Biol. Cell 15, 3642-3657.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Plant CellHome page
J. Chan, A. Sambade, G. Calder, and C. Lloyd
Arabidopsis Cortical Microtubules Are Initiated along, as Well as Branching from, Existing Microtubules
PLANT CELL, August 1, 2009; 21(8): 2298 - 2306.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
K. L. Farquharson
On the Origin of Cortical Microtubules
PLANT CELL, August 1, 2009; 21(8): 2193 - 2193.
[Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
jcs.035238v1
122/8/1134    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fant, X.
Right arrow Articles by Merdes, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fant, X.
Right arrow Articles by Merdes, A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?