Skip to main content

Main menu

  • Home
  • Articles
    • Advance articles
    • Current issue
    • Issue archive
    • Archive by article type
    • Interviews
    • Subject collections
    • Alerts
  • About us
    • About JCS
    • Editors and Board
    • Editor biographies
    • Travelling Fellowships
    • Grants and funding
    • Workshops and Meetings
    • The Company of Biologists
    • Journal news
  • For authors
    • Submit a manuscript
    • Aims and scope
    • Presubmission enquiries
    • Article types
    • Manuscript preparation
    • Cover suggestions
    • Editorial process
    • Promoting your paper
    • Open Access
    • JCS Prize
    • Biology Open transfer
  • Journal info
    • Journal policies
    • Rights and permissions
    • Media policies
    • Reviewer guide
    • Alerts
  • Contact
    • Contact JCS
    • Subscriptions
    • Advertising
    • Feedback
  • COB
    • About The Company of Biologists
    • Development
    • Journal of Cell Science
    • Journal of Experimental Biology
    • Disease Models & Mechanisms
    • Biology Open

User menu

  • Log in

Search

  • Advanced search
Journal of Cell Science
  • COB
    • About The Company of Biologists
    • Development
    • Journal of Cell Science
    • Journal of Experimental Biology
    • Disease Models & Mechanisms
    • Biology Open

supporting biologistsinspiring biology

Journal of Cell Science

  • Log in
Advanced search

RSS   Twitter  Facebook   YouTube  

  • Home
  • Articles
    • Advance articles
    • Current issue
    • Issue archive
    • Archive by article type
    • Interviews
    • Subject collections
    • Alerts
  • About us
    • About JCS
    • Editors and Board
    • Editor biographies
    • Travelling Fellowships
    • Grants and funding
    • Workshops and Meetings
    • The Company of Biologists
    • Journal news
  • For authors
    • Submit a manuscript
    • Aims and scope
    • Presubmission enquiries
    • Article types
    • Manuscript preparation
    • Cover suggestions
    • Editorial process
    • Promoting your paper
    • Open Access
    • JCS Prize
    • Biology Open transfer
  • Journal info
    • Journal policies
    • Rights and permissions
    • Media policies
    • Reviewer guide
    • Alerts
  • Contact
    • Contact JCS
    • Subscriptions
    • Advertising
    • Feedback
Research Article
Distinct effects of thrombopoietin depending on a threshold level of activated Mpl in BaF-3 cells
Gaël A. Millot, William Vainchenker, Dominique Duménil, Fédor Svinarchuk
J Cell Sci 2002 115: 2329-2337;
Gaël A. Millot
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
William Vainchenker
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Dominique Duménil
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Fédor Svinarchuk
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & tables
  • Info & metrics
  • PDF
Loading

Summary

Thrombopoietin (TPO) plays a critical role in megakaryopoiesis through binding to its receptor Mpl. This involves activation of various intracellular signaling pathways, including phosphoinositide 3-kinase (PI3K) and the mitogen-activated protein kinase (MAPK) pathways. Their precise role in TPO-mediated proliferation, survival and differentiation is not fully understood. In the present study, we show that TPO induces different biological responses in Mpl-transduced BaF-3 cells, depending on the cell surface density of Mpl and the resulting activation level of signaling pathways. TPO mediates cell proliferation in cells expressing high levels of Mpl but only mediates survival without proliferation in cells expressing low levels of the receptor. By using the kinase inhibitors PD98059 and LY294002, we further showed that the activation level of the PI3K and MAPK p42/44 pathways is a determining factor for the proliferative effect. In cells expressing low levels of Mpl, the survival effect was strongly dependent on the activation level of the PI3K/AKT, but not the MAPK p42/44 pathway. Moreover, this effect was correlated with the phosphorylation level of BAD but not with the expression level of Bcl-XL. However, PI3K pathway inhibition did not increase apoptosis when BaF-3 cells proliferated in response to TPO, indicating a compensating mechanism from other Mpl signaling pathways in this case.

  • Mpl
  • Threshold activation level
  • Proliferation
  • Survival
  • Signaling pathways

Introduction

TPO is a ligand for the Mpl receptor ( de Sauvage et al., 1994; Lok et al., 1994; Wendling et al., 1994), a member of the hematopoietic growth factor receptor superfamily. This family of receptors is characterized by conserved cysteine residues, a common amino acid motif (WSXWS) in the extracellular domain, and the absence of intrinsic tyrosine kinase activity in the intracellular domain. A high level of cell surface expression of Mpl appears to be limited to hematopoietic cells belonging to the megakaryocytic platelet lineage, from colony-forming unit-megakaryocyte (CFU-MK) progenitors to mature platelets ( Debili et al., 1995a). Cell surface expression of Mpl is also detected on murine LinloSca+c-kit+ and human CD34+CD38- primitive cell populations ( Solar et al., 1998).

The function of the Mpl/TPO system is well characterized. Numerous experiments have shown that TPO stimulates proliferation and differentiation of megakaryocytic progenitors in vitro and in vivo ( Debili et al., 1995b; Kaushansky et al., 1995). More recently, Mpl- and TPO-deficient mice were reported to exhibit a drastic decrease in the number of platelets and cells of the megakaryocytic lineage ( Gurney et al., 1994), demonstrating a major role for Mpl activation in megakaryopoiesis and platelet production. The Mpl/TPO system also acts on more primitive cells. Mpl- and TPO-deficient mice showed a 50% reduction in the absolute number of all myeloid-committed progenitors ( Alexander et al., 1996). In vitro, TPO alone promotes survival of early hematopoietic progenitors ( Jacobsen et al., 1996; Borge et al., 1997; Matsunaga et al., 1998) and in combination with early-acting cytokines such as stem cell factor (SCF), FLT3 ligand or interleukin 3 (IL-3) it greatly increases the production of committed progenitors ( Ku et al., 1996; Ramsfjell et al., 1996; Ramsfjell et al., 1997). These data indicate that, in addition to its essential function for megakaryopoiesis, Mpl activation is required to maintain and/or expand early and committed myeloid progenitor cells.

Binding of TPO to the Mpl receptor leads to the phosphorylation and activation of numerous signaling molecules, including those in the JAK/STAT pathway, the MAPK pathway and the PI3K pathway ( Drachman et al., 1995; Sattler et al., 1997; Matsumura et al., 1998). Their involvement in cellular events such as survival, proliferation and differentiation has been described but their precise role in TPO-mediated biological responses is not fully understood.

In the present study, we show that signaling pathways activated by TPO produce distinct effects in Mpl-transduced BaF-3 cells, depending on the level of expression of Mpl on the cell surface. TPO mediates cell proliferation in cells expressing high levels of cell surface Mpl, whereas it mediates cell survival alone (without proliferation) in cells expressing low levels of the Mpl receptor. In addition, we defined the roles of Mpl signaling pathways in these different effects.

Materials and Methods

Cytokines, antibodies and reagents

WEHI-3B conditioned medium was used as a source of murine IL-3. Human recombinant TPO was a generous gift from Kirin (Tokyo, Japan). Mouse anti-Flag M1 monoclonal antibody was purchased from Sigma (Saint-Quentin Fallavier, France) and R-Phycoerythrin (R-PE)-conjugated goat F(ab′)2 anti-mouse antibody from Caltag (Burlingame, CA). Mouse anti-phospho-ERK and rabbit anti-phospho-STAT5, -phospho-AKT and -AKT antibodies were provided by New England Biolabs (Berverly, MA); rabbit anti-STAT5, -ERK1, -ERK2 and BAD were from SCB (Santa Cruz, CA); and mouse anti-Bcl-x were from BD Transduction Lab (Lexington, KY). Horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies were from Jackson Immunoresearch (West Grove, PA). PD98059 MEK inhibitor was purchased from Calbiochem (San Diego, CA), and LY294002 PI3K inhibitor, AG490 JAK2 inhibitor and propidium iodide (PI) were from Sigma.

Cell lines

The murine cell line BaF-3 ( Palacios and Steinmetz, 1985) and BaF3-Mpl clones were maintained in RPMI 1640 medium (Gibco, Paisley, UK) supplemented with 10% fetal calf serum (FCS, Gibco) and 3% WEHI-3B-conditioned medium. NIH-3T3 and 293 EBNA (Invitrogen, Groningen, The Netherlands) cell lines were cultured in DMEM medium (Gibco) with 10% FCS.

Plasmid constructs

Full-length human c-DNA from pZen-MplP-SVNeo ( Goncalves et al., 1997) was used for constructions. To introduce the Flag epitope tag, a 115 bp oligonucleotide duplex 5′-cgttaacatgttccatgtttcttttagatatatctttggaattcctccactgatccttgttctgctgcctgtcactagttctgattacaaagatgacgatgacaagccgtcttct-3′ / 5′-ctagagaagacggcttgtcatcgtcatctttgtaatcagaactagtgacaggcagcagaacaaggatcagtggaggaattccaaagatatatctaaaagaaacatggaacatgttaacgagct-3′ encoding the IL-7 leader ( Park et al., 1990), the Flag sequences ( Brizzard et al., 1994) and BbsI restriction site were inserted into the SacI/XbaI sites of the vector pBluescript II (Stratagene, La Jolla, CA) to obtain the plasmid pSKFlag. To introduce the Mp1 coding sequence in frame with the IL7 and Flag sequences, a part of the extracellular domain of Mpl was amplified with a 0.1 μg of pZen-Mp1P-SVNeo with a sense primer (5′-cctagaagacctcaagcaagatgtctccttg-3′), corresponding to the BbsI restriction site, cohesive end on the pSKFlag after cutting with BbsI, and Mpl sequence starting immediately after the leader coding sequence, and an antisense primer (5′-gttccaccctctgctgtcag-3′) located downstream of HindIII site in the Mp1 cDNA. After cutting with BbsI and HindIII, the PCR product was ligated into the corresponding sites of the pSKFlag vector. A HindIII/XhoI fragment from pZen-Mpl-SVNeo was inserted into the corresponding sites of this plasmid in order to obtain the full-length Flag-Mpl cDNA. The fidelity of inserts was confirmed by sequencing. Flag-Mpl cDNA was then subcloned into the HpaI/XhoI sites of the murine stem cell virus-based bicistronic retroviral vector MIGR-IRES-GFP (generous gift of J. P. Miller, University of Pennsylvania, Philadelphia, PA) in which the original polylinker (BglII, XhoI, HpaI and EcoRI) was replaced by the sequence 5′-gatctagaattctgtcgacagttaactgcggccgcactcgag-3′ and the SalI site downstream of GFP was mutated by SalI cutting, blunting by Klenow and religation.

Retroviral infection

The Flag-Mpl receptor construct cloned into the retroviral vector MIGR-IRES-GFP enables the simultaneous expression of the receptor protein and the green fluorescent protein (GFP), and allows the selection of infected cells based on GFP expression using a fluorescence-activated cell sorter (FACS). Transient MIGR-Flag-Mpl supernatant production was accomplished by transfecting the 293 EBNA cell line that has an amphotropic host range. To improve the stability of the retrovirus particles, we chose a vesicular stomatitis virus G (VSV-G) pseudotyping technique. Briefly, 0.5 μg of each MIGR-Flag-Mpl, VSV-G and gag-pol plasmids were co-transfected using EXGEN reagent according to the manufacturer's recommendations (Euromedex, Souffelweyersheim, France). Cells were washed at 24 hours and supernatants were collected at 48 hours, filtered and frozen at -80°C. This strategy regularly gives a transfection efficiency of 50% and a viral titer of 106 CFU/ml by monitoring the number of GFP-positive cells in the NIH-3T3 cell line (data not shown).

Supernatants were used to infect BaF-3 cells. Cells were washed once and 105 cells were cultured for 48 hours in 6-well tissue culture plates (Falcon Grenoble, France) containing 2 ml of RPMI, 10% FCS, 6% WEHI-3B, 50% retroviral supernatant and 4 μg/ml of polybrene. After infection, cells were maintained in RPMI, 10% FCS, 3% WEHI-3B for 2 days. Highly GFP-positive cells were then cloned at one cell per well into 96-well tissue culture plates using a FACS Vantage flow cytometer (Becton Dickinson, San Jose, CA). These BaF3-Mpl clones were named Clone A, B, C... and were used as clones expressing high levels of Mpl receptor on their cell surface. To obtain clones expressing low levels of Mpl on their cell surface, a pool of faintly GFP-positive cells was also sorted and maintained in RPMI, 10% FCS, 3% WEHI-3B for 7 days. Cells were then labeled with anti-Flag and PE-goat anti-mouse antibodies as described below, and Flag-positive cells were cloned at one cell per well into 96-well tissue culture plates using the FACS Vantage flow cytometer. Thirty clones were randomly selected and named clone 1, 2, 3... 30. To increase Mpl expression in the low-level-expressing clones, clones 8, 16 and 28 were retransduced with the Mpl retroviral construct as described above for BaF-3 parental cells, and a pool of highly GFP- and Flag-positive cells were sorted. These three retransduced pools derived from clones 8, 16 and 28 were named clone 8+, 16+ and 28+. To avoid any alteration in the Mpl cell surface expression, aliquots of each clone were thawed every 3 weeks and during this lapse of time, receptor expression was regularly monitored by flow cytometric analysis.

Proliferation assays

Cells were washed three times and 2500 cells per well were plated into 96-well tissue culture plates (Falcon) containing RPMI, 10% FCS and the indicated concentration of TPO or 5% WEHI-3B as a control. After incubation at 37°C for the indicated time, 10 μCi of [3H]thymidine (specific activity 185 GBq/mmol; Amersham, Courtabœuf, France) was added to each well and the cells further incubated for 4 hours at 37°C prior to scintillation counting.

Cell stimulation

Cells were washed three times and resuspended at 4×106 cells/ml in RPMI alone. After a starvation of 3 hours at 37°C, cells were left unstimulated or stimulated with 50 ng/ml of TPO for 15 minutes at 37°C. When used, inhibitors were added at the indicated concentration 30 minutes before TPO stimulation. For long-term stimulation, cells were washed three times and directly resuspended at 2×106 cells/ml (for western blots analysis) or 4×105 cells/ml (for apoptosis analysis) in RPMI, 10% FCS with 10 ng/ml of TPO. When used, inhibitors were added at the indicated concentration together with TPO. DMSO (Sigma) was used as a control for the inhibitor studies at 1.4 μl/ml, which corresponded to the maximum concentration of DMSO present during these experiments.

Flow cytometric analysis

A saturating concentration of antibodies was used for all labeling. Because binding of M1 anti-Flag antibody is dependent on calcium, 1 mM of CaCl2 was added to the buffer during all incubations and washes. Cells (5×105/sample) were washed and incubated in PBS and 0.5% FCS for 10 minutes at 4°C with 8.4 μg/ml of mouse M1 anti-Flag antibody or left unlabelled. After two washes, cells were labeled with 0.4μ g/ml of PE-conjugated goat anti-mouse antibody for 20 minutes at 4°C. Cells were then washed once and analysed for fluorescence with a FACScan flow cytometer (Becton Dickinson). For apoptosis analysis, 4×105 cells were collected from stimulated cultures (see above), washed once and labeled overnight in 400 μl of citrate buffer containing 25 μg/ml PI, 50μ g/ml RNase (Merck, Darmstadt, Germany) and 0.1% Nonidet P40 (Sigma), in the dark at 4°C. Percentages of apoptotic cells, corresponding to cells with sub-cell cycle PI incorporation, were determined by flow cytometry using a FACSort (Becton Dickinson).

Western blot analysis

Cell stimulation was blocked by washing cells with 50 ml of cold 1×PBS. Total cell lysates were obtained by incubating 108 cells/ml in a hypertonic buffer containing 1/100 Triton X-100, 20 mM Hepes pH 7.9, 350 mM NaCl, 10 mM KCl, 1 mM EDTA pH 8, 20% glycerol, 1/25 Complete Protease Inhibitors (Boehringer Mannheim, Germany) and 1 mM Na2SO4. Lysates were incubated for 30 minutes at 4°C, centrifuged at 13,000 g for 6 minutes at 4°C, then supernatants were stored at -80°C until used. Protein concentration was determined using the Bio-Rad DC Protein colorimetric assay (Hercules, CA). Unless specified, 60 μg of protein per sample was used and further analysed as described ( Rosa Santos et al., 2000).

Results

Activation of Mpl signaling pathways but absence of TPO-mediated proliferation in clones with low levels of cell surface expression of Mpl

The BaF-3 cell line is strictly dependent on IL-3 for its survival and does not respond to TPO. Human Mpl, tagged with the Flag epitope sequence at the N-terminus of the receptor, was introduced into BaF-3 cells by retroviral infection and clones expressing low levels of the retroviral vector were derived. Four clones, named clone 16, 8, 28 and 14 were then selected for their increasing levels of Mpl cell surface expression ( Fig. 1A), and were compared with clones A and C, which were derived from cells expressing high levels of retroviral vector.

  Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1.

A threshold number of cell-surface Mpl receptors is necessary for TPO-induced proliferation of BaF-3 cells. (A) Flow cytometric analysis of Mpl-expressing clones. A Flag-Mpl receptor construct was introduced into BaF-3 cells and clones were derived. Cell surface expression of Mpl was examined for each clone by Flag-PE immunostaining: broken line, unlabeled cells; solid line, labeled cells. (B) Proliferation assay. Cells were incubated with the indicated concentration of TPO for 48 hours and cell proliferation was quantitated by [3H]thymidine incorporation. The results shown are the means±s.d. of triplicate experiments. (C) Western blots analysis of signaling pathways activated in clones stimulated by TPO. Cells were washed three times, deprived of cytokines for 3 hours, and then stimulated with 50 ng/ml of TPO for 15 minutes. Lysates (60 μg of protein per lane) were fractionated by SDS-PAGE.

Phosphorylated (upper panel) and total (lower panel) STAT-5, ERK and AKT were analyzed by immunoblotting. ns, no stimulation. The positions of ERK1 (p44) and ERK2 (p42) are indicated.

Clones A and C exhibited a proliferative response to TPO ( Fig. 1B) but only clone 14, which expressed an equivalent level of Mpl on the cell surface, was able to give a similar result. Although expressing significant levels of Mpl on their cell surface, [3H]thymidine incorporation by clones 16, 8 and 28 after TPO treatment was low and not significantly different from that of BaF-3 parental cells, even when the TPO concentration exceeded 100 ng/ml (data not shown). This result indicated that a threshold level of activated Mpl was necessary for TPO-mediated proliferation of BaF-3 cells. When signaling pathway activities were studied, phosphorylation levels of STAT5, ERK and AKT were found to be very similar for clones 14, A and C after 15 minutes of TPO stimulation ( Fig. 1C). These signaling pathways were also activated in clones 16, 8 and 28, but at a lower level than that observed for clones 14, A and C. These results therefore suggested that proliferation of Mpl-transduced BaF-3 cells requires a threshold activation level of Mpl signaling pathways.

Overexpression of Mpl in low-Mpl-expressing clones restores TPO-induced cell proliferation

To confirm that insufficient Mpl cell surface expression was responsible for the absence of TPO-mediated proliferation, clones 16, 8 and 28 were retransduced with the Mpl retroviral construct and, for each clone, the most Flag-positive cells were sorted. These three Mpl-overexpressing clones were named clone 16+, 8+ and 28+ ( Table 1). After 48 hours of TPO stimulation, a proliferative response similar to that of clone 14 was observed for clones 16+, 8+ and 28+, in contrast to the absence of [3H]thymidine incorporation by parental clones 16, 8 and 28 ( Fig. 2A; Fig. 1B). This indicated that the low Mpl expression on the cell surface was responsible for the absence of TPO-mediated proliferation of clone 16, 8 and 28. Study of signaling pathways demonstrated that the phosphorylation levels of STAT5, ERK and AKT were significantly increased after 15 minutes of TPO stimulation for clones 16+, 8+ and 28+ compared with parental clones 16, 8 and 28, and in fact were similar to the phosphorylation levels observed in clone 14 ( Fig. 2B; Fig. 1C). This suggested that a threshold activation level of Mpl signaling pathways was necessary for TPO-mediated proliferation of Mpl-transduced BaF-3 cells.

View this table:
  • View inline
  • View popup
Table 1.

Flag antigen expression on cell surface of clones expressing and overexpressing Mpl

  Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2.

Proliferation and high activation of signaling pathways are restored in previously underexpressing clones that were retransduced to increase expression of Mpl. (A) Proliferation assay. Cells were incubated with the indicated concentration of TPO for 48 hours and cell proliferation was quantitated by [3H]thymidine incorporation. The results shown are the means±s.d. of triplicate experiments. (B) Western blots analysis of signaling pathways activated in clones stimulated by TPO. Cells were washed three times, deprived of cytokines for 3 hours, and then stimulated with 50 ng/ml of TPO for 15 minutes. Activation of STAT-5, ERK and AKT were determined as described in Fig. 1. ns, no stimulation.

TPO induces a survival effect in low-Mpl-expressing clones

The anti-apoptotic effect of TPO was examined by quantifying the sub-G1 peak after propidium iodide incorporation. As expected, parental BaF-3 cells exhibited an identical pattern of time-dependent appearance of apoptotic cells when either cytokine-deprived or stimulated with TPO ( Fig. 3). In contrast, 10 ng/ml of TPO fully inhibited apoptosis of clone 14 ( Fig. 3) and clone A (data not shown), even after 34 hours of stimulation, whereas more than 80% of the cells were in the sub-G1 peak after 34 hours of cytokine deprivation. At this concentration, a clear anti-apoptotic effect of TPO was also observed in clones with low levels of Mpl expression. Therefore, although insufficient for TPO-induced cell proliferation, the level of Mpl cell surface expression of clones 16, 8 and 28 was sufficient to provide TPO-mediated cell survival. However, this effect was transient, as it did not permanently protect cells from apoptosis but delayed its appearance. Indeed, compared with cytokine-deprived cells, the TPO-induced survival effect was maximal at 15 hours for clone 16 (73% versus 36% of apoptotic cells, respectively, a decrease of 37%), at 21 hours for clone 8 (a decrease of 40%) and at 24 hours for clone 28 (a decrease of 72%).

  Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3.

Effect of TPO on cell survival in clones with low levels of Mpl expression on their cell surface. Cells were washed three times and left deprived of cytokines or stimulated with 10 ng/ml of TPO. At the indicated time, cells were collected and labeled with propidium iodide. Percentages of apoptotic cells in the sub-G1 peak were determined by flow cytometry. Results are representative of two independent experiments.

The influence of TPO concentration was also studied ( Fig. 4). A TPO concentration of between 10 pg/ml and 1 ng/ml was required for both proliferation and survival events in clones 14 and A. In contrast, clones 16, 8 and 28 responded to increasing TPO concentrations by yielding reduced numbers of apoptotic cells, but without a significant change in [3H]thymidine incorporation. Therefore, TPO mediated distinct effects in Mpl-transduced BaF-3 cells, depending on a threshold level of activated Mpl: TPO induced proliferation at high levels of cell surface expression of Mpl, but survival alone without a proliferative effect at low levels of Mpl expression. The survival effect remained transient in low-Mpl-expressing clones, even when TPO concentrations exceeded 100 ng/ml (data not shown).

  Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4.

TPO-dependent survival and proliferation of clones expressing Mpl. (A) Cells were washed three times and stimulated with various concentrations of TPO. At the indicated times, cells were either labeled with PI and percentages of apoptotic cells determined by flow cytometry (right axix) or cell proliferation was quantitated by [3H]thymidine incorporation (left axis). The results shown for [3H]thymidine incorporation are means±s.d. of triplicate experiments. Results are representative of two independent experiments.

Study of Mpl signaling pathways indicated that ERK and AKT were still activated after 9 hours of TPO stimulation in clones 16, 8 and 28, but to a lesser extent than in clone 14 and A ( Fig. 5A). However, phosphorylation of STAT5 was clearly observed in clones 14 and A, but was at the limit of detection in clone 28 and not detectable in clones 8 and 16.

  Fig. 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 5.

Western blot analysis of signaling pathway intermediates activated in Mpl-expressing clones after long-term TPO stimulation. Cells were washed three times and stimulated with 10 ng/ml of TPO for 3 or 9 hours. Cells were lysed and 60 μg of protein per lane was fractioned by SDS-PAGE. Lysate of clone A deprived of cytokines for 3 hours was used as a control. (A) Activation of STAT-5, ERK and AKT after 9 hours of TPO stimulation was analyzed as described in Fig. 1. (B) Expression level of Bcl-XL and BAD phosphorylation analyzed by immunoblotting with anti-Bcl-x and anti-BAD antibodies. As a control, blots labeled with the anti-Bcl-x antibody were stripped and relabeled with a mouse anti-actin antibody. ns, no stimulation. Positions of unphosphorylated (BAD), singly (BADP1) and doubly phosphorylated BAD (BADP2) are indicated.

Cytokines suppress apoptosis by regulating expression of bcl-2 family members. STAT5 regulates the expression of the anti-apoptotic protein Bcl-XL and the pro-apoptotic signaling protein BAD is inactived after phosphorylation by AKT ( del Peso et al., 1997; Dumon et al., 1999). In our clones, the expression level of Bcl-XL did not correlate with the phosphorylation level of Mpl signaling pathways. After 3 hours of TPO stimulation, the expression level was slightly decreased in clone 14 and A, compared with clone 16, 8 and 28, and was similar between clones after 9 hours of TPO stimulation ( Fig. 5B). This suggests that the TPO-mediated survival effect observed in Mpl-expressing clones did not depend on the expression level of Bcl-XL. In contrast, TPO-induced phosphorylation of BAD in clones 16, 8 and 28 after 3 hours of stimulation, compared with unstimulated cells ( Fig. 5B). This result indicated that the activation level of signaling pathways in clones with low levels of Mpl expression, was sufficient to inactivate BAD. Moreover, the phosphorylation level of BAD decreased markedly in clones 8 and 28 after 9 hours of TPO stimulation, and was at the limit of detection in clone 16, whereas it was still observed in clones 14 and A. This result indicated that BAD was transiently inactivated by TPO in clones with low levels of Mpl expression and this phenomenon correlated with the transient nature of the alternative TPO-mediated survival effect.

Analyses of Mpl signaling pathways involved in the TPO-mediated proliferative and survival effect

Inhibition of ERK activation with 50 μM of the MEK inhibitor PD98059 resulted in a more than twofold decrease of TPO-mediated proliferation in clone A (3642±359 cpm of [3H]thymidine incorporation, versus 10,213±453 cpm with TPO alone; Fig. 6A) and clone 14 (3765±388 cpm versus 7981±243 cpm, data not shown). A similar effect was obtained with 10 μM of the P13K inhibitor LY294002 (3423±117 cpm for clone A, Fig. 6A; and 2639±163 for clone 14, data not shown). These results indicated that the activation level of both MAPK p42/44 and P13K pathways was a determining factor for the TPO-mediated proliferation of Mpl-transduced BaF-3 cells.

  Fig. 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 6.

The P13K/AKT pathway is involved in the TPO-mediated survival effect observed in clones with low levels of Mpl expression. (A) Proliferation assays. Cells of clone A were washed three times and left cytokine-deprived or incubated for 24 hours with 10 ng/ml of TPO, solvent alone (0.14% DMSO), or the indicated concentration of inhibitors. Cell proliferation was quantitated by [3H]thymidine incorporation. The results shown are means±s.d. of triplicate experiments. (B) Western blot analysis of STAT-5, ERK and AKT activation. Cells from clone A were washed three times, deprived of cytokines for 3 hours and stimulated with 50 ng/ml of TPO for 15 minutes, DMSO (inhibitor solvent) alone, 50 μM of the MEK inhibitor PD98059 or 10 μM of the P13K inhibitor LY294002. Activation of STAT5, ERK and AKT was analyzed as described in Fig. 1. ns, no stimulation. (C) Apoptosis analysis. Cells were washed three times and left cytokine-deprived or stimulated for 22 hours with 10 ng/ml of TPO, solvent alone (0.14% DMSO), or the indicated concentration of inhibitors. Cells were then labeled with PI and percentages of apoptotic cells were determined by flow cytometry. Results are representative of two independent experiments.

The P13K inhibitor LY294002 at a concentration of 10 μM fully abolished phosphorylation of AKT after TPO stimulation but did not abolish ERK or STAT5 actively ( Fig. 6B). At this concentration, the transient survival effect of clone 28 after 22 hours of TPO stimulation ( Fig. 6C) was decreased twofold with 80% apoptotic cells, versus 44% with solvent alone (DMSO). This result indicated that the PI3K inhibitor strongly inhibited the TPO-mediated survival effect, since the percentage of dead cells increased to approximately the same level as that observed without TPO stimulation (99%). The same result was obtained with clone 8 (69% apoptotic cells with LY294002, 35% with DMSO alone and 89% without TPO stimulation; data not shown). In combination, these results indicated that the activation level of the PI3K pathway was a determining factor for the alternative TPO-mediated survival effect. However, 10 μM of LY294002 did not affect the TPO-mediated survival of clones A and 14 ( Fig. 6C, and data not shown), even though activity was totally abolished in clone A ( Fig. 6B) and although TPO-mediated proliferation was partially inhibited by LY294002 in clone A ( Fig. 6A) and clone 14 (data not shown). These results therefore indicated that activation of the PI3K pathway was not essential for survival when Mpl-transduced BaF-3 cells proliferate in response to TPO.

Inhibition of ERK activation by 50 μM of the MEK inhibitor PD98059 ( Fig. 6B) did not affect the TPO-mediated survival of clone 28 (44% apoptotic cells; Fig. 6C) and clone 8 (36%; data not shown). Also, it did not inhibit the TPO-mediated survival of clone A and 14 ( Fig. 6C, and data not shown), despite a level of inhibition of TPO-mediated proliferation similar to that obtained with 10 μM of LY294002. This result indicated that the MAPK p42/44 pathway was not involved in the TPO-mediated survival of Mpl-transduced BaF-3 cells, despite long-term activation of ERK in clones with low levels of Mpl expression.

Discussion

Previous studies have reported that the Mpl/TPO system is involved in both cell proliferation and survival effects. In the present study, we demonstrate that TPO induces different biological responses in Mpl-transduced BaF-3 cells, depending on the cell surface density of Mpl and the resulting level of activation of different signaling pathways. TPO mediates cell proliferation in cells expressing high levels of Mpl but mediates only survival without proliferation in cells expressing low levels of the receptor. We further demonstrated that the activation level of the PI3K and MAPK p42/44 pathways is a determining factor for the proliferative effect. The cell survival effect was strongly dependent on the activation level of the PI3K/AKT, but not the MAPK p42/44 pathway. However, PI3K pathway inhibition did not induce apoptosis when BaF-3 cells with high levels of Mpl proliferated in response to TPO.

The PI3K and MAPK p42/44 pathways have been reported to be involved in TPO-mediated proliferation of BaF-3 cells ( Dorsch et al., 1997; Rojnuckarin et al., 1999; Geddis et al., 2001). In the present study, we show that the activation level of MAPK p42/44 and PI3K was higher in the proliferative effect than in the cell survival effect. Moreover, the inhibitors LY294002 and PD98059 impaired TPO-mediated proliferation of BaF-3 cells. Together, our results suggest that the TPO-mediated proliferation of BaF-3 cells requires a threshold stimulation level of both PI3K and MAPK p42/44 pathways that depends on the cell surface density of Mpl. Several studies in other systems reported the cooperation of these pathways in the proliferation event ( Craddock et al., 2001; Pozios et al., 2001; Zubilewicz et al., 2001). It has also been reported that constitutively active forms of the p110 catalytic subunit of PI3K leads to oncogenic transformation without significant activation of ERK, indicating that activation of the MAPK p42/44 pathway is not essential for cell growth ( Aoki et al., 2000). Conversely, constitutively active forms of MEK lead to factor-independent proliferation, suggesting that activation of MAPK p42/44 is sufficient for triggering cell growth ( Mansour et al., 1994; Seger et al., 1994). These findings suggest that cell-cycle entry could be governed by stimulation of signaling pathways involved in proliferation, but that the nature of the activated signaling pathway is not a determining factor. Additionally, we cannot exclude that the activation level of STAT5 is involved in the triggering of the TPO-mediated proliferative effect in our system, which would require further detailed studies.

Our results also indicate that the cell survival effect is associated with weak but sustained activation of the PI3K pathway, and inactivation of BAD. Use of the LY294002 inhibitor demonstrated a major contribution of PI3K activation in this effect. Majka et al. have recently reported that the PI3K/AKT pathway is involved in the TPO-mediated inhibition of apoptosis in megakaryoblasts ( Majka et al., 2000), a finding that is consistent with our results. However, our results demonstrate that inhibition of the PI3K/AKT pathway does not affect cell survival when cells are actively proliferating in response to TPO. This result suggests that, in the proliferative effect, the activation level of other Mpl signaling pathways is sufficient to compensate for the inhibition of AKT and to prevent apoptosis. Such an effect has already been reported in BaF-3 cells, whereby the simultaneous inhibition of the PI3K/AKT pathway by LY294002 and of STAT5 by a dominant-negative isoform, is necessary for reducing IL-3-dependent survival. LY294002 inhibited the phosphorylation of BAD and the dominant-negative isoform of STAT5 affected the Bcl-XL expression ( Rosa Santos et al., 2000). Here we show that the Bcl-XL expression is not increased when BaF-3 cells proliferate in response to TPO. This suggests that, in this case, another mechanism compensates for the inhibition of AKT and for survival of proliferating cells. The JAK2 inhibitor AG490 at a concentration of 25 μM strongly affected the proliferation of clone A and decreased the transient survival effect of clone 8 and 28 after TPO stimulation (data not shown). However, neither phosphorylation of STAT5, nor phosphorylation of ERK and AKT after TPO stimulation was affected by AG490 at this concentration in clones A and 28 (data not shown). Therefore, we were not able to conclude on the involvement of STAT5 in the TPO-mediated proliferative and survival effect. This would require further analysis. We also demonstrate a weak but sustained activation of ERKs in the cellular survival effect in the absence of proliferation. However, the PD98059 inhibitor did not affect the anti-apoptotic effect mediated by TPO in BaF-3 cells. Similar results were reported in megakaryoblast ( Fichelson et al., 1999; Majka et al., 2000), indicating that MAPK p42/44 pathway activation is not essential for the TPO-mediated survival event.

Taken together, our results underscore the importance of quantitative differences in receptor activation in the generation of qualitatively different biological responses (reviewed by Zandstra et al., 2000). The biological responses mediated by the Mpl receptor are dependent on the activity of downstream signaling pathways being sustained over a threshold level: PI3K and MAPK p42/44 activity for the proliferative effect, and PI3K activity for the cell survival effect in the absence of proliferation, although a different mechanism is involved in cell survival when cells are actively proliferating. In our system, the cell survival effect in the absence of proliferation is transient. We were unable to maintain permanent survival of BaF-3 cells expressing low levels of Mpl in the absence of a proliferative response to TPO. This result suggests that proliferation and permanent survival are linked effects in our system.

A threshold level of activity of signaling pathways has already been reported in the case of TPO-mediated differentiation involving the MAPK p42/44 pathway ( Rouyez et al., 1997; Matsumura et al., 1998; Rojnuckarin et al., 1999). This effect of MAPK p42/44 could not be evaluated in our system because BaF-3 cells do not differentiate in response to TPO, even in the presence of an overactive form of ERK2 ( Rojnuckarin et al., 1999). Thus, it is possible that our results do not accurately reflect the proliferative and cell survival mechanisms that operate in primary megakaryocytic cells. Nevertheless, our system could highlight the way by which TPO alone acts as a survival factor of early hematopoietic progenitors and, in synergy with other cytokines, as a proliferative factor of these cells. Further studies using primary hematopoietic cells will be required to validate this hypothesis.

Acknowledgements

We thank Isabelle Dusanter-Fourt, Claudie Lamour-Isnard, Bernard G. Forget, Jonathan Dando and Adrian Schubert for critical reading of the manuscript; Yann Lecluse for cell sorting; and Susana Constantino Rosa Santos, Françoise Labaille and Vincent Hascoët for technical support. Special thanks go to Marthe Chotard. Human recombinant TPO was a generous gift from Kirin (Tokyo, Japan). This work was supported by the Association de Recherche contre le Cancer and INSERM. G.A.M. is supported by the Fondation pour la Recherche Médicale (FRM) and the Société Française d'Hématologie (SFH).

  • Accepted March 11, 2002.
  • © The Company of Biologists Limited 2002

References

  1. ↵
    Alexander, W. S., Roberts, A. W., Nicola, N. A., Li, R. and Metcalf, D. ( 1996). Deficiencies in progenitor cells of multiple hematopoietic lineages and defective megakaryocytopoiesis in mice lacking the thrombopoietic receptor c-Mpl. Blood 87, 2162 -2170.
    OpenUrlAbstract/FREE Full Text
  2. ↵
    Aoki, M., Schetter, C., Himly, M., Batista, O., Chang, H. W. and Vogt, P. K. ( 2000). The catalytic subunit of phosphoinositide 3-kinase: requirements for oncogenicity. J. Biol. Chem. 275, 6267 -6275.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    Borge, O. J., Ramsfjell, V., Cui, L. and Jacobsen, S. E. ( 1997). Ability of early acting cytokines to directly promote survival and suppress apoptosis of human primitive CD34+CD38- bone marrow cells with multilineage potential at the single-cell level: key role of thrombopoietin. Blood 90, 2282 -2292.
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Brizzard, B. L., Chubet, R. G. and Vizard, D. L. ( 1994). Immunoaffinity purification of FLAG epitope-tagged bacterial alkaline phosphatase using a novel monoclonal antibody and peptide elution. Biotechniques 16, 730 -735.
    OpenUrlPubMedWeb of Science
  5. ↵
    Craddock, B. L., Hobbs, J., Edmead, C. E. and Welham, M. J. ( 2001). Phosphoinositide 3-kinase-dependent regulation of IL-3-induced proliferation:involvement of mitogen-activated protein kinases, SHP2 and Gab2. J. Biol. Chem. 276, 24274 -24283.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Debili, N., Wendling, F., Cosman, D., Titeux, M., Florindo, C., Dusanter-Fourt, I., Schooley, K., Methia, N., Charon, M., Nador, R. et al. ( 1995a). The Mpl receptor is expressed in the megakaryocytic lineage from late progenitors to platelets. Blood 85, 391 -401.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Debili, N., Wendling, F., Katz, A., Guichard, J., Breton-Gorius, J., Hunt, P. and Vainchenker, W. ( 1995b). The Mpl-ligand or thrombopoietin or megakaryocyte growth and differentiative factor has both direct proliferative and differentiative activities on human megakaryocyte progenitors. Blood 86, 2516 -2525.
    OpenUrlAbstract/FREE Full Text
  8. ↵
    del Peso, L., Gonzalez-Garcia, M., Page, C., Herrera, R. and Nunez, G. ( 1997). Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt. Science 278, 687 -689.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    de Sauvage, F. J., Hass, P. E., Spencer, S. D., Malloy, B. E., Gurney, A. L., Spencer, S. A., Darbonne, W. C., Henzel, W. J., Wong, S. C., Kuang, W. J. et al. ( 1994). Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand. Nature 369, 533 -538.
    OpenUrlCrossRefPubMed
  10. ↵
    Dorsch, M., Fan, P. D., Danial, N. N., Rothman, P. B. and Goff, S. P. ( 1997). The thrombopoietin receptor can mediate proliferation without activation of the Jak-STAT pathway. J. Exp. Med. 186, 1947 -1955.
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Drachman, J. G., Griffin, J. D. and Kaushansky, K. ( 1995). The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation of Jak2, Shc and c-Mpl. J. Biol. Chem. 270, 4979 -4982.
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Dumon, S., Santos, S. C., Debierre-Grockiego, F., Gouilleux-Gruart, V., Cocault, L., Boucheron, C., Mollat, P., Gisselbrecht, S. and Gouilleux, F. ( 1999). IL-3 dependent regulation of Bcl-xL gene expression by STAT5 in a bone marrow derived cell line. Oncogene 18, 4191 -4199.
    OpenUrlCrossRefPubMedWeb of Science
  13. ↵
    Fichelson, S., Freyssinier, J. M., Picard, F., Fontenay-Roupie, M., Guesnu, M., Cherai, M., Gisselbrecht, S. and Porteu, F. ( 1999). Megakaryocyte growth and development factor-induced proliferation and differentiation are regulated by the mitogen-activated protein kinase pathway in primitive cord blood hematopoietic progenitors. Blood 94, 1601 -1613.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Geddis, A. E., Fox, N. E. and Kaushansky, K. ( 2001). Phosphatidylinositol 3-kinase is necessary but not sufficient for thrombopoietin- induced proliferation in engineered Mpl-bearing cell lines as well as in primary megakaryocytic progenitors. J. Biol. Chem. 276, 34473 -34479.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Goncalves, F., Lacout, C., Villeval, J. L., Wendling, F., Vainchenker, W. and Dumenil, D. ( 1997). Thrombopoietin does not induce lineage-restricted commitment of Mpl-R expressing pluripotent progenitors but permits their complete erythroid and megakaryocytic differentiation. Blood 89, 3544 -3553.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Gurney, A. L., Carver-Moore, K., de Sauvage, F. J. and Moore, M. W. ( 1994). Thrombocytopenia in c-mpl-deficient mice. Science 265, 1445 -1447.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Jacobsen, S. E., Borge, O. J., Ramsfjell, V., Cui, L., Cardier, J. E., Veiby, O. P., Murphy, M. J. and Lok, S. ( 1996). Thrombopoietin, a direct stimulator of viability and multilineage growth of primitive bone marrow progenitor cells. Stem Cells 14 Suppl. 1, 173 -180.
    OpenUrl
  18. ↵
    Kaushansky, K., Broudy, V. C., Lin, N., Jorgensen, M. J., McCarty, J., Fox, N., Zucker-Franklin, D. and Lofton-Day, C. ( 1995). Thrombopoietin, the Mpl ligand, is essential for full megakaryocyte development. Proc. Natl. Acad. Sci. USA 92, 3234 -3238.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Ku, H., Yonemura, Y., Kaushansky, K. and Ogawa, M. ( 1996). Thrombopoietin, the ligand for the Mpl receptor, synergizes with steel factor and other early acting cytokines in supporting proliferation of primitive hematopoietic progenitors of mice. Blood 87, 4544 -4551.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Lok, S., Kaushansky, K., Holly, R. D., Kuijper, J. L., Lofton-Day, C. E., Oort, P. J., Grant, F. J., Heipel, M. D., Burkhead, S. K., Kramer, J. M. et al. ( 1994). Cloning and expression of murine thrombopoietin cDNA and stimulation of platelet production in vivo. Nature 369, 565 -568.
    OpenUrlCrossRefPubMed
  21. ↵
    Majka, M., Janowska-Wieczorek, A., Ratajczak, J., Kowalska, M. A., Vilaire, G., Pan, Z. K., Honczarenko, M., Marquez, L. A., Poncz, M. and Ratajczak, M. Z. ( 2000). Stromal-derived factor 1 and thrombopoietin regulate distinct aspects of human megakaryopoiesis. Blood 96, 4142 -4151.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    Mansour, S. J., Matten, W. T., Hermann, A. S., Candia, J. M., Rong, S., Fukasawa, K., Vande Woude, G. F. and Ahn, N. G. ( 1994). Transformation of mammalian cells by constitutively active MAP kinase kinase. Science 265, 966 -970.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    Matsumura, I., Nakajima, K., Wakao, H., Hattori, S., Hashimoto, K., Sugahara, H., Kato, T., Miyazaki, H., Hirano, T. and Kanakura, Y. ( 1998). Involvement of prolonged ras activation in thrombopoietin-induced megakaryocytic differentiation of a human factor-dependent hematopoietic cell line. Mol. Cell. Biol. 18, 4282 -4290.
    OpenUrlAbstract/FREE Full Text
  24. ↵
    Matsunaga, T., Kato, T., Miyazaki, H. and Ogawa, M. ( 1998). Thrombopoietin promotes the survival of murine hematopoietic long-term reconstituting cells: comparison with the effects of FLT3/FLK-2 ligand and interleukin-6. Blood 92, 452 -461.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Palacios, R. and Steinmetz, M. ( 1985). IL-3-dependent mouse clones that express B-220 surface antigen, contain Ig genes in germ-line configuration, and generate B lymphocytes in vivo. Cell 41, 727 -734.
    OpenUrlCrossRefPubMedWeb of Science
  26. ↵
    Park, L. S., Friend, D. J., Schmierer, A. E., Dower, S. K. and Namen, A. E. ( 1990). Murine interleukin 7 (IL-7) receptor. Characterization on an IL-7-dependent cell line. J. Exp. Med. 171, 1073 -1089.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Pozios, K. C., Ding, J., Degger, B., Upton, Z. and Duan, C. ( 2001). IGFs stimulate zebrafish cell proliferation by activating MAP kinase and PI3-kinase-signaling pathways. Am. J. Physiol. Regul. Integr. Comp. Physiol. 280, R1230 -R1239.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Ramsfjell, V., Borge, O. J., Cui, L. and Jacobsen, S. E. ( 1997). Thrombopoietin directly and potently stimulates multilineage growth and progenitor cell expansion from primitive (CD34+ CD38-) human bone marrow progenitor cells: distinct and key interactions with the ligands for c-kit and flt3, and inhibitory effects of TGF-beta and TNF-alpha. J. Immunol. 158, 5169 -5177.
    OpenUrlAbstract
  29. ↵
    Ramsfjell, V., Borge, O. J., Veiby, O. P., Cardier, J., Murphy, M. J., Lyman, S. D., Lok, S. and Jacobsen, S. E. ( 1996). Thrombopoietin, but not erythropoietin, directly stimulates multilineage growth of primitive murine bone marrow progenitor cells in synergy with early acting cytokines: distinct interactions with the ligands for c-kit and FLT3. Blood 88, 4481 -4492.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Rojnuckarin, P., Drachman, J. G. and Kaushansky, K. ( 1999). Thrombopoietin-induced activation of the mitogen-activated protein kinase (MAPK) pathway in normal megakaryocytes: role in endomitosis. Blood 94, 1273 -1282.
    OpenUrlAbstract/FREE Full Text
  31. ↵
    Rosa Santos, S. C., Dumon, S., Mayeux, P., Gisselbrecht, S. and Gouilleux, F. ( 2000). Cooperation between STAT5 and phosphatidylinositol 3-kinase in the IL-3-dependent survival of a bone marrow derived cell line. Oncogene 19, 1164 -1172.
    OpenUrlCrossRefPubMedWeb of Science
  32. ↵
    Rouyez, M. C., Boucheron, C., Gisselbrecht, S., Dusanter-Fourt, I. and Porteu, F. ( 1997). Control of thrombopoietin-induced megakaryocytic differentiation by the mitogen-activated protein kinase pathway. Mol. Cell. Biol. 17, 4991 -5000.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Sattler, M., Salgia, R., Durstin, M. A., Prasad, K. V. and Griffin, J. D. ( 1997). Thrombopoietin induces activation of the phosphatidylinositol-3′ kinase pathway and formation of a complex containing p85PI3K and the protooncoprotein p120CBL. J. Cell Physiol. 171, 28 -33.
    OpenUrlCrossRefPubMedWeb of Science
  34. ↵
    Seger, R., Seger, D., Reszka, A. A., Munar, E. S., Eldar-Finkelman, H., Dobrowolska, G., Jensen, A. M., Campbell, J. S., Fischer, E. H. and Krebs, E. G. ( 1994). Overexpression of mitogen-activated protein kinase kinase (MAPKK) and its mutants in NIH 3T3 cells. Evidence that MAPKK involvement in cellular proliferation is regulated by phosphorylation of serine residues in its kinase subdomains VII and VIII. J. Biol. Chem. 269, 25699 -25709.
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Solar, G. P., Kerr, W. G., Zeigler, F. C., Hess, D., Donahue, C., de Sauvage, F. J. and Eaton, D. L. ( 1998). Role of c-mpl in early hematopoiesis. Blood 92, 4-10.
    OpenUrlAbstract/FREE Full Text
  36. ↵
    Wendling, F., Maraskovsky, E., Debili, N., Florindo, C., Teepe, M., Titeux, M., Methia, N., Breton-Gorius, J., Cosman, D. and Vainchenker, W. ( 1994). cMpl ligand is a humoral regulator of megakaryocytopoiesis. Nature 369, 571 -574.
    OpenUrlCrossRefPubMedWeb of Science
  37. ↵
    Zandstra, P. W., Lauffenburger, D. A. and Eaves, C. J. ( 2000). A ligand-receptor signaling threshold model of stem cell differentiation control: a biologically conserved mechanism applicable to hematopoiesis. Blood 96, 1215 -1222.
    OpenUrlAbstract/FREE Full Text
  38. ↵
    Zubilewicz, A., Hecquet, C., Jeanny, J., Soubrane, G., Courtois, Y. and Mascarelli, F. ( 2001). Proliferation of CECs requires dual signaling through both MAPK/ERK and PI 3-K/Akt pathways. Invest. Ophthalmol. Vis. Sci. 42, 488 -496.
    OpenUrlAbstract/FREE Full Text
View Abstract
Previous ArticleNext Article
Back to top
Previous ArticleNext Article

Current Issue

 Download PDF

Email

Thank you for your interest in spreading the word on Journal of Cell Science.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Distinct effects of thrombopoietin depending on a threshold level of activated Mpl in BaF-3 cells
(Your Name) has sent you a message from Journal of Cell Science
(Your Name) thought you would like to see the Journal of Cell Science web site.
Share
Distinct effects of thrombopoietin depending on a threshold level of activated Mpl in BaF-3 cells
Gaël A. Millot, William Vainchenker, Dominique Duménil, Fédor Svinarchuk
J Cell Sci 2002 115: 2329-2337;
Permalink:
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools
Distinct effects of thrombopoietin depending on a threshold level of activated Mpl in BaF-3 cells
Gaël A. Millot, William Vainchenker, Dominique Duménil, Fédor Svinarchuk
J Cell Sci 2002 115: 2329-2337;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Alerts

Please log in to add an alert for this article.

Sign In to Email Alerts with your Email Address

Article navigation

  • Top
  • Article
    • Summary
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgements
    • References
  • Figures & tables
  • Info & metrics
  • PDF

Related articles

Cited by...

More in this TOC section

  • PATELLINS are regulators of auxin-mediated PIN1 relocation and plant development in Arabidopsis thaliana
  • Nonmuscle myosin II-B regulates epicardial integrity and epicardial derived mesenchymal cell maturation
  • Polyphosphate as donor of high-energy phosphate for the synthesis of ADP and ATP
Show more RESEARCH ARTICLE

Similar articles

Other journals from The Company of Biologists

Development

Journal of Experimental Biology

Disease Models & Mechanisms

Biology Open

Cell scientist to watch − Jacky Goetz

Jacky Goetz

“…I […] love to communicate science – to give seminars, and to talk about our discoveries in the lab.”

Jacky Goetz leads the Tumor Biomechanics group at the IGBMC in Strasbourg, working on intravital imaging methods and biomechanical forces during tumour progression. In this interview he reveals his fascination with observing and unravelling unexpected features of biology, and why it's important for researchers to follow their intuition.


Commentary − Lamins in the nuclear interior: life outside the lamina

Mouse immortalised dermal fibroblasts with labelled  LAP2α and lamins A/C

Nana Naetar, Simona Ferraioli and Roland Foisner discuss recent advances in the regulation of the lamina-independent pool of lamins in the nucleoplasm and their emerging functions in chromatin organization, mechanical regulation and disease.


Meeting report − Intercellular interactions in context: towards a mechanistic understanding of cells in organs 

Attendees of the Intercellular interactions in context: towards a mechanistic understanding of cells in organs workshop

Reporting on The Company of Biologists' recent Workshop, David Bryant and Aaron Johnson present the questions that arose from the Workshop and suggest these questions should be posed to the fields of cell, cancer and developmental biology at large.


Mole − Peerless I

Mole reviews grant proposalsIt's never easy to see your grant proposal torpedoed. Our resident talpid reflects on his recent time on a grant evaluation panel and offers insights into what happens behind closed doors as reviewers burrow though mounds of proposals.


Transfer to Biology Open

If your submission to Journal of Cell Science is unsuccessful, did you know you can transfer your paper and any reviews directly to our sister journal, Biology Open? The majority of papers transferred with reviews are accepted for publication. Find out how here.

Articles

  • Advance articles
  • Current issue
  • Issue archive
  • Subject collections
  • Interviews
  • Archive by article type
  • Alerts

About us

  • About Journal of Cell Science
  • Editors and Board
  • Editor biographies
  • Travelling Fellowships
  • Grants and funding
  • Workshops and Meetings
  • The Company of Biologists

For Authors

  • Submit a manuscript
  • Aims and scope
  • Presubmission enquiries
  • Article types
  • Manuscript preparation
  • Figure preparation
  • Cover suggestions
  • Editorial process
  • Promoting your paper
  • Open Access
  • JCS Prize
  • Biology Open transfer

Journal Info

  • Journal policies
  • Rights and permissions
  • Media policies
  • Reviewer guide
  • Alerts

Contact

  • Contact Journal of Cell Science
  • Subscriptions
  • Advertising
  • Feedback

Twitter   YouTube   LinkedIn

© 2017   The Company of Biologists Ltd   Registered Charity 277992