Etv5a regulates the proliferation of ventral mesoderm cells and the formation of hemato-vascular derivatives

The circulatory system is one of the first functioning organ systems to develop in vertebrate embryos. The coordinated development of the heart, blood vessels and blood cells allows for the establishment of blood circulation, which is crucial for early survival. During gastrulation, the mesoderm is induced and patterned across the dorsal–ventral axis; later, the ventral mesoderm cells proliferate and differentiate to form a transient progenitor cell termed the hemangioblast, which gives rise to both endothelial and hematopoietic cell lineages (Amatruda and Zon, 1999; Lugus et al., 2005; Orkin and Zon, 2008; Patan, 2000; Xiong, 2008). Subsequently, during both vasculogenesis and angiogenesis, the endothelial cells line the vasculature, whereas hematopoietic progenitors differentiate into distinct blood lineages through hematopoiesis. Studies in different vertebrate models showed that these developmental processes and the genetic program that controls them are generally conserved throughout vertebrate evolution (Orkin and Zon, 2008; Paik and Zon, 2010).

Several molecules play a vital role in the formation of the circulatory system. The GATA family of transcription factors is essential for both primitive and definitive hematopoiesis. Gata1 is required for the proper maturation of erythroid, mast and megakaryocytic precursors, and for the specification of eosinophils, whereas Gata2 is necessary for mast cell development and for the maintenance and expansion of hematopoietic stem cells (Fujiwara et al., 2004; Ohneda and Yamamoto, 2002). Gata3 is required for the development of T lymphocytes (Hosoya et al., 2009). Other critical factors in hematopoiesis are Rag1, which is essential for the differentiation of T and B lymphocytes (Petrie-Hanson et al., 2009), and Runx1, which regulates the formation of hematopoietic progenitors, myeloid cells and the vasculature (Jin et al., 2012; Kalev-Zylinska et al., 2002). The development of endothelial cells and vascular patterning is regulated by the vascular endothelial growth factor (VEGF) receptors Flt1 and Flk1 (Hirashima, 2009; Orkin and Zon, 1997; Siekmann et al., 2008), whereas the basic helix–loop–helix transcription factor Scl is crucial for both hematopoiesis and vasculogenesis (Gering et al., 1998). Although the molecules that regulate the formation of blood cells and blood vessels are well characterized, those involved in the specification of the hemangioblastic fate in ventral mesoderm are less well characterized.

Ets transcription factors contain a conserved winged helix–turn–helix ETS domain that is essential for DNA binding. Members of this family play multiple roles in cell proliferation, differentiation and migration, and many of them are essential for hematopoiesis and blood vessel development (Liu and Patient, 2008). For example, Ets1, Ets2 and Fli1 regulate both vaculogenesis and angiogenesis (Randi et al., 2009). Etsrp is required to drive haemangioblasts towards a vascular fate and is essential for the formation of myeloid cells (Ellett et al., 2009; Sumanas and Lin, 2006). Erg is essential for normal adult hematopoietic stem cell homeostasis as well as endothelial differentiation and vascular development (Kruse et al., 2009; Randi et al., 2009). Similarly, defects in many human ETS genes have been associated with cancer, such as leukemia (Sharrocks, 2001).

Zebrafish (Danio rerio) has emerged as an excellent vertebrate model for the study of many aspects of the developmental process of the circulatory system, not only because of the transparency of the embryos, which facilitates in vivo imaging, but also because the embryos can survive for many days without circulating erythrocytes. In addition, most of the molecules involved in the development of the circulatory system are evolutionary conserved in this species (Belele et al., 2009). Here, we show that one Ets gene, etv5a, is expressed in the ventral mesoderm in zebrafish embryos. Knockdown of endogenous etv5a by antisense morpholinos resulted in increased proliferation of ventral mesoderm cells and defective hematopoietic cell and vascular endothelium cell formation, without affecting other mesodermal derivatives. The effect of the morpholino knockdown was phenocopied by overexpression of a dominant-negative etv5a construct. Our data provide further insights into the roles of Etv5a in the formation of the ventral mesoderm and hemato-vascular cell lineages.

Zebrafish etv5a (previously named etv5) and etv5b (erm) are both homologous to mammalian ETV5 and arose from a gene duplication in ray-finned fish (Roussigné and Blader, 2006). Sequence comparison showed that zebrafish Etv5a displays more similarities with other vertebrate ETV5 proteins than Etv5b (supplementary material Fig. S1A) (also see Roussigné and Blader, 2006; Liu and Patient, 2008). A syntenic comparison of etv5a with mammalian homologs showed that gene loci flanking the zebrafish etv5a gene (chromosome 9) are highly conserved in human chromosome 3, mouse chromosome 16 and rat chromosome 11 (supplementary material Fig. S1B). Conversely, zebrafish etv5b is located in chromosome 6 and lacks significant synteny (supplementary material Fig. S1C). These results substantiate the hypothesis that zebrafish etv5a is orthologous to mammalian ETV5.

etv5a expression was analyzed by whole-mount in situ hybridization and quantitative real-time PCR of zebrafish embryos at developmental stages ranging from one-cell stage to 48 hours post fertilization (hpf). A strong and ubiquitous signal was detected from one-cell to the oblong stage, which indicated that etv5a was expressed as a maternal mRNA (Fig. 1A–C). Ubiquitous expression was observed throughout the whole embryo before gastrulation (Fig. 1D,E). During early gastrulation (75% epiboly), expression localized to the ventral mesoderm (arrowhead in Fig. 1F,G). At later stages, etv5a expression became confined to the lateral mesoderm as demonstrated by the presence of two longitudinal stripes at the six-somite stage (Fig. 1H–J). A previous study showed that cells present in this region are multipotent progenitors that give rise to hematopoietic, endothelial and pronephric derivatives (Gering et al., 1998). etv5a expression was maintained in the posterior lateral mesoderm (Fig. 1K–N) during segmentation, but after 24 hpf it became restricted to the developing pronephric progenitors (Fig. 1O–T). In addition to mesodermal tissues, etv5a expression was detected in the developing nervous system, specifically in the brain and spinal cord, at the six-somite stage, and was maintained until the latest stage analyzed (48 hpf, Fig. H–U). The dynamic expression of etv5a suggests its importance in the developing central nervous system and mesodermal derivatives. By contrast, etv5b (erm) is expressed in the developing nervous system but not in the ventral mesoderm, lateral mesoderm or pronephric ducts (Münchberg et al., 1999; Raible and Brand, 2001). Mouse Etv5 is also strongly expressed in the developing nervous system and in the intermediate and lateral plate mesoderm, but it is expressed late in the mesonephros (Chotteau-Lelièvre et al., 1997; Chotteau-Lelièvre et al., 2001). The results presented here reveal that the expression of Etv5 and etv5a orthologs is evolutionary conserved.

To delineate the role of Etv5a during embryonic development, the morpholino (MO) knockdown approach was used to interfere with Etv5a expression. To block protein production, two 25 bp antisense morpholinos (MO1 and MO2) were synthesized to target different regions located upstream of the translation start site of etv5a mRNA. The specificity of the MOs was confirmed by rescue experiments in which the MOs were coinjected with cRNA for etv5a, as described for each experiment below. To confirm the efficacy of the MO knockdown approach, each of the two etv5a MOs was co-injected with the cRNA of a reporter construct that contained the etv5a MO1 and MO2 binding sequences upstream of an enhanced green fluorescent protein reporter (5′etv5a-EGFP). Effective knockdown, as revealed by the loss of EGFP protein, was observed upon co-injection with either of the two etv5a MOs, whereas no reduction in EGFP protein expression was observed upon co-injection of a control MO (supplementary material Fig. S2A).

Embryos injected with MO1 or MO2 were analyzed at 24 hpf, 2 days post-fertilization (dpf), 3 dpf and 4 dpf for morphological defects. The injection of 2 ng of MO1 or 10 ng of MO2 resulted in identical phenotypes (supplementary material Fig. S3) and therefore only embryos injected with 2 ng of MO1 are shown. Although knockdown of etv5a did not result in significant morphological abnormalities (supplementary material Fig. S2B), it caused a reduced heart beat rate (control, 75.28±5.82 beats/minutes; etv5a morphants, 32.43±4.53 beats/minutes at 24 hpf) and a lower blood cell count at all stages analyzed. Concomitant injection of MOs with etv5a cRNA rescued these phenotypes, indicating that the MO-induced defect was due to loss of Etv5a function.

The reduced number of blood cells observed in etv5a morphants suggested a hematopoietic defect; thus, we examined the formation of erythroid cells by assessing the expression of gata1, a marker of erythroid precursors (Detrich et al., 1995), by in situ hybridization and quantitative real-time PCR. The results showed that gata1 expression was downregulated in etv5a-knockdown embryos (Fig. 2). We also found that injection of etv5a MOs downregulated markers for granulocytes (mpo) (Bennett et al., 2001) and lymphoid cells (rag1) (Willett et al., 1997) (Fig. 2). These results suggested that the common progenitor for these hematopoietic derivatives was affected by loss of Etv5a. Further analysis of gata2, which marks hematopoietic stem cells at the ten-somite stage (Detrich et al., 1995; Yamauchi et al., 2006), demonstrated that its expression was decreased in etv5a-knockdown embryos (Fig. 2), indicating that Etv5a is required for the formation of hematopoietic stem cells.

We next analyzed the formation of blood vessels by using Tg(fli1:eGFP) zebrafish embryos in which vascular endothelial cells are labeled with green fluorescent protein (Bennett et al., 2001). In etv5a-knockdown embryos, the main artery and vein initially formed at 24 hpf; however, the GFP fluorescence was significantly weaker than in the controls, as shown by direct observation and quantification of GFP by western blot analysis (Fig. 3). The defect in blood vessel formation became more severe as angiogenesis progressed, as evidenced by the weaker GFP signals in the intersomitic and sub-intestinal venous vessels, the formation of which is used as an indicator of proper angiogenesis (Isogai et al., 2001) (Fig. 3A).

During development, blood and endothelial cells develop from a common progenitor, the hemangioblast (Gering et al., 1998). Because our results showed defects in both blood cells and vessels, we examined the expression of scl, which marks hemangioblasts in lateral plate mesoderm (Gering et al., 1998). During normal development, transcripts for scl were seen in two pairs of lateral stripes flanking the mesoderm. By contrast, scl expression was downregulated in Etv5a-knockdown embryos (Fig. 2A,B). Taken together, these results show that knockdown of Etv5a is sufficient to inhibit the formation of hemato-vascular progenitors, which results in defective hematopoiesis and vasculogenesis.

Previous studies have shown that MOs can cause off-target apoptosis mediated by p53 activation (Robu et al., 2007). To rule out this possibility, all of the etv5a MOs were co-injected with a tp53 MO. The results showed no significant differences between the phenotypes of embryos co-injected with etv5a and tp53 MOs or those injected with etv5a MO alone (Fig. 2). Because the phenotypes caused by injection of etv5a MO were also rescued by concomitant injection of etv5a cRNA as noted above, the phenotypes of the etv5a morphants were not the result of p53 activation but the result of specific inhibition of Etv5a function.

In zebrafish embryos, hemangioblasts originate from the lateral plate mesoderm, which is itself derived from the ventral mesoderm (Bockamp et al., 2009; Davidson and Zon, 2004). We next examined the expression of eve1, which is specifically restricted to the ventral mesoderm during gastrulation (Seebald and Szeto, 2011). Intriguingly, the expression of eve1 was significantly upregulated in etv5a morphants (Fig. 4A,B). The increase in the expression of eve1 was not a result of embryo ventralization because head and notochord structures, which are the first structures affected in ventralized embryos, were morphologically normal (Neave et al., 1997) (supplementary material Fig. S2). The observed increase in eve1 could, however, result from increased cell proliferation, reduced cell death, or inhibition of differentiation of ventral mesoderm cells. We first examined cell proliferation by phospho-histone-H3 antibody and counterstained with eve1, which revealed increased proliferation of ventral mesoderm cells in etv5a morphants (Fig. 4C–F). We next assessed apoptosis by detecting the presence of activated caspase-3 using immunohistochemistry. No significant differences were observed between etv5a morphants and controls at 75% epiboly (Fig. 5). Intriguingly, significantly increased numbers of apoptotic cells were detected 2 hours later at the tail-bud stage and this abnormally increased apoptosis ceased 1 hour later (six-somite stage), suggesting that the apoptosis was triggered by deregulation of proliferation. These results demonstrate that knockdown of Etv5a increases the proliferation of ventral mesoderm cells.

In addition to hemato-vascular progenitors, the ventral mesoderm also gives rise to somites, pronepheric cells and the gut wall. To examine whether knockdown of etv5a affects other ventral mesoderm derivatives, the expression of myoD (a marker for early somitic mesoderm) (Weinberg et al., 1996), pax2a (a marker of pronephric ducts) (Majumdar et al., 2000) and foxf1 (a marker of the gut wall) (Madison et al., 2009) were analyzed. The results show that the expression of these markers was not affected by Etv5a knockdown (supplementary material Fig. S4), suggesting that Etv5a specifically regulates the formation of the hemato-vascular lineage. Taken together, these findings demonstrate that the proliferation of ventral mesoderm cells and the differentiation of hemato-vascular progenitors are dependent on the proper expression of Etv5a.

Widespread expression of Etv5a by injection of etv5a cRNA did not show any significant phenotype compared with the controls (Fig. 6B,C). To gain insight into the structural requirements for Etv5a function, we created two deletion variants: one lacking the region containing the ETS DNA-binding domain up to the C-terminus of Etv5a (etv5a^ΔETS) and the other lacking the N-terminus, including the acidic domain (etv5a^Δacidic) (Fig. 6A). Injection of etv5a^ΔETS cRNA did not result in any significant change in the phenotype compared with controls (Fig. 6B,C). However, injection of etv5a^Δacidic resulted in reduced levels of all hematopoietic derivatives including hematopoietic stem cells and hemangioblasts (Fig. 6B,C) and increased the expression of the ventral mesoderm marker eve1 (Fig. 6B,C). The phenotypes caused by injection of etv5a^Δacidic were identical to those observed in Etv5a-knockdown embryos. These results indicate that although deletion of the N-terminus including the acidic domain (etv5a^Δacidic), abolishes Etv5a transactivation, the remaining ETS motif might compete with endogenous Etv5a for the DNA binding site, thereby causing a dominant-negative effect. By contrast, deletion of the ETS domain (etv5a^ΔETS) would produce a non-functional protein that is incapable of competing with endogenous Etv5a. These results confirm the specificity of the phenotypes conferred by injection of etv5a MO.

In this study, we used etv5a MOs and a dominant-negative etv5a variant to show that interference with etv5a expression in zebrafish embryos results in an increase in the proliferation of ventral mesoderm cells. The formation of hemato-vascular derivatives was also defective, whereas other derivatives developed normally. These abnormally proliferated hemangioblastic ventral mesoderm cells later underwent apoptosis during a very short time interval and consequently caused defective hematopoietic cells and vessels; however, cell differentiation seemed unaffected because those cells that escaped apoptosis differentiated normally according to the residual expression of hematopoietic and vascular markers. Taken together, our results suggest that Etv5a specifically regulates the proliferation of ventral mesoderm cells with hemato-vascular potential.

Molecules and regulatory mechanisms involved in the development of mesoderm cells and their progeny have attracted increasing attention because of their potential applications in regenerative medicine and stem-cell-based therapies for human diseases. The mechanisms involved in hematopoiesis are well characterized; however, only a small number of factors involved in ventral mesoderm and hemato-vascular specification have been identified. Only a few mutant lines showing defects in mesoderm and mesodermal derivatives are available in zebrafish. Moreover, the defects in these cell lines are not restricted to the hemato-vascular lineage but also affect many other mesodermal derivatives (Davidson et al., 2003; Gering et al., 1998; Griffin et al., 1998; Thompson et al., 1998). Our results showing that Etv5a specifically regulates the formation of the hemato-vascular lineage without affecting other mesodermal derivatives, suggests that etv5a is one of the earliest players in the generation of the hemato-vascular progenitors from the ventral mesoderm. By contrast, the cloche (clo) mutant displays severe deficiencies in the development of both endothelial and all hematopoietic cells, without affecting pronephros or somite formation, indicating that cloche regulates mesoderm cell specification and that the cloche mutation specifically affects hemangioblast formation (Stainier et al., 1995). The phenotype caused by Etv5a deficiency is similar to that of the cloche mutant, suggesting a possible interaction between Etv5a and Cloche. However, whether Etv5a and Cloche interact and work synergetically to regulate proliferation of ventral mesoderm requires further confirmation.

Several molecules belonging to the BMP, FGF and Wnt signaling pathways have been implicated as early inducers and patterning factors of the ventral mesoderm; however, how they direct the ventral mesoderm into different cell fates is still unclear. Here, we showed that Etv5a is a novel regulator of ventral mesodermal proliferation and specification. To our knowledge, Etv5a is the first transcription factor shown to be essential for the inhibition of proliferation of ventral mesoderm cells and for hemato-vascular specification. However, the upstream regulator for Etv5a in ventral mesoderm proliferation still remains to be identified. A previous study in mouse embryos demonstrated that BMP signaling positively regulates the expression of another Ets transcription factor, Er71/etsrp, in mesoderm cells, which contribute to hematopoietic and endothelial, skeletal, and smooth muscle cell lineages (Lee et al., 2008). A study in zebrafish also showed that BMP signaling was required for the expression of fli1 (also a member of Ets family) in hemangioblasts of the lateral mesoderm (Liu et al., 2008). We also found that inhibition of BMP signaling upregulated etv5a expression (data not shown). Previous studies in zebrafish showed that etv5a transcription was downregulated by inhibition of the FGF signaling pathway at 24 hpf (Mao et al., 2009; Roussigné and Blader, 2006). By contrast, we found that inhibition of FGF or MEK signaling did not affect the expression of etv5a at 75% epiboly (data not shown). Therefore, how etv5a responds to BMP and FGF signaling and whether this regulation is essential for ventral mesodermal proliferation remains to be examined.

ETV5/ERM regulates cell proliferation in several tumor cell lines and during spermatogenesis, and has been suggested to act as a proto-oncogene (Chen et al., 2005; Oh et al., 2012). Our results demonstrate that Etv5a is essential for the proliferation of mesoderm cells and suggest that Etv5a is a positive regulator of development of the hemato-vascular lineage. However, embryos overexpressing the full etv5a cRNA had a normal phenotype. A possible explanation for this finding is that ETV5/ERM protein requires phosphorylation for its activity (Janknecht et al., 1996). Therefore, it will be interesting to determine whether activated Etv5a is sufficient to induce abnormal hematopoiesis and vasculogenesis. In line with this idea, ETV5 is overexpressed in lymphoid leukemia and lymphoma (Charfi et al., 2011; Korz et al., 2002), which also reinforces the positive correlation between ETV5 expression and hematopoiesis. Whether the embryonic role of Etv5 found in this study is a feature of leukemias and other tumors warrants further investigation.

All experiments were performed in strict accordance to standard guidelines for zebrafish work and approved by the Institutional Animal Care and Use Committee of Chang Gung University (IACUC approval number: CGU08-86 and CGU11-118).

Tü (wild-type) zebrafish embryos were purchased from the Zebrafish International Resource Center (ZIRC; Eugene, OR) and were raised, maintained and paired under standard conditions. Tg(fli1:eGFP) zebrafish was obtained from Taiwan Zebrafish Core Facility at ZeTH with permission from Zebrafish International Resource Center (ZIRC). The embryos were staged according to the number of somites, hours post fertilization and days post fertilization (Kimmel et al., 1995).

Amino acid sequences were aligned and displayed using Vector NTI (Invitrogen). Phylogenetic trees were constructed with ClustalX (Thompson et al., 1997). The GenBank accession numbers of the compared proteins are as follows: human ETV5/ERM (NM_004454.2); rat ETV5/ERM (NM_001107082.1); mouse ETV5/ERM (NM_023794.2); chicken ETV5 (XM_422651.2); zebrafish Etv5a (NM_001126461.1), Etv5b (NM_131205.1).

The open reading frame of zebrafish etv5a was PCR amplified with high-fidelity Pfu polymerase (Fermentas) and primers (5′-GAATTCGCCACCATGGACGGATTTTATGACC-3′and 5′- GGAATTCCTCAGTACACGTAACCATCAGGG-3′) which were designed according to the GenBank sequence (accession number: NM_001126461.1). etv5a^ΔETS was created with primers 5′-GGAATTCATGGACGGATTTTATGACCAGCAAG-3′ and 5′-GCTCTAGAGAGATCCGCGCCGCTGATATG-3′, whereas etv5a^Δacidic was made with primers 5′-GGAATTCATGTCGGAGAGCTTGATGTTTCATG-3′ and 5′-GCTCTAGAGTCAGTACACGTAACCATCAGG-3′. etv5a MO1 and MO2 binding sequences were inserted upstream of an enhanced green fluorescent protein reporter in the pCS2 vector to create the 5′rgs4-EGFP construct to evaluate the specificity and efficiency of MOs.

Capped RNAs encoding the full coding sequence of Etv5a, etv5a^ΔETS and etv5a^Δacidic were prepared as described previously (Chung et al., 2011). Antisense MO oligonucleotides were purchased from Gene Tools, LLC (Philomath, OR). Two morpholinos against etv5a were used: MO1 (TCACCTGGGTCTTCAAAGAGGCTCC), which overlaps the ATG start codon (−26 to −2), and MO2 (GATCTTCGCTTAAAAGCGATAGCTG), which corresponds to −59 to −35 at the translation start site. Blast analysis revealed homology of less than 20 bp identity for MO1 or MO2 to other genomic sequences; none of which corresponded to 5′ UTR or exon–intron splicing site of predicted or characterized genes, suggesting that MO1 and MO2 will act specifically on etv5a. A control MO designed against a random sequence of nucleotides not found in the zebrafish genome (5′-CCTCTTACCTCAGTTACAATTTATA-3′; Gene Tools) and an MO with a five-base mismatch to MO1 (5′-TCAgCTGGgTCTTgAAAGAcGCTgC-3′; mismatched bases are indicated by lowercase letters) was injected in an equal amount of MO1 as a control experiment. All injections were performed at the one- to two-cell stage and cRNAs or morpholinos were introduced into blastomeres.

Digoxigenin-UTP-labeled riboprobes were synthesized according to the manufacturer's instructions (Roche) and in situ hybridizations were performed as described previously (Cheng et al., 2012). The color reaction was carried out using NBT/BCIP substrate (Roche). For immunohistochemistry, the embryos were blocked in 5% goat serum and incubated with rabbit phospho-histone H3 antibody or rabbit monoclonal anti-active caspase-3 (1∶200, Abcam). Goat anti-mouse IgG HRP or goat anti-rabbit IgG HRP (Roche) was used to detect the primary antibodies and DAB was used as a substrate for secondary-antibody-conjugated HRP (Amresco). Embryos were mounted with Vectashield mounting medium (Vector Laboratories).

For quantitative real-time PCR (qPCR), embryos were homogenized in TRIzol reagent (Invitrogen) and total RNA was extracted using a standard method. cDNA was synthesized from total RNA with random hexamer priming using RevertAid First Strand cDNA Synthesis Kit (Fermentas). qPCR was performed on an ABI StepOne Real-Time PCR System (Applied Biosystems) with SYBR green fluorescent label (Fermentas). Primers used were eve1: F, 5′-CCCTGGTTAGGTGGTCTTCCA-3′ and R, 5′-GGGTTGTAGGCCTGTCCTAGCT-3′; scl: F, 5′-CGCAGACCTGCACCTTATGA-3′ and R, 5′-AGGGTGTGTTGGGATGAGCTT-3′; gata2: F, 5′-AAGCACGGCTCCAGTTTCCT-3′ and R, 5′-TCCTTTTCGTCCATTCTTGCA-3′; gata1: F, 5′-ACACAGTCCAGTTCGCCAAGT-3′ and R, 5′-TGGAGAGGTGTTTTTGGGAAA-3′; mpo: F, 5′-TCTTTTTGCCTGCCTGATTTC-3′ and R, 5′-ATTCCGGTGTTGTCGCAGAT-3′; rag1: F, 5′-CACTAAGCTCATCCCCACTGAAG-3′ and R, 5′-CCCAAAGCATGGGTGTACCT-3′. Gene expression levels were normalized to gapdh and assessed using the comparative CT (40 cycles) according to the manufacturer's instructions (Applied Biosystems).

For western blot analysis, embryos were homogenized in SDS lysis buffer. 60 µg were loaded on 12% SDS polyacrylamide gel and transferred to a PVDF membrane and detected with anti-GFP monoclonal antibody (1∶1000, Invitrogen). After washing, membranes were incubated with goat anti-Mouse HRP-conjugated secondary antibody (Chemicon) and developed with ECL (Millipore). Band intensities were quantified using Multi Gaugre analysis software.

Statistical analysis was performed by Student's t-test using Microsoft Excel 2007. The significance level was set at P<0.05. All reactions were performed in triplicate for each sample.

We are grateful to Taiwan Zebrafish Core facility at ZeTH and Zebrafish Core in Academia Sinica for providing fish.