The checkpoint proteins Rad9, Rad1 and Hus1 form a clamp-like complex which plays a central role in the DNA-damage-induced checkpoint response. Here we address the function of the 9-1-1 complex in Drosophila. We decided to focus our analysis on the meiotic and somatic requirements of hus1. For that purpose, we created a null allele of hus1 by imprecise excision of a P element found 2 kb from the 3′ of the hus1 gene. We found that hus1 mutant flies are viable, but the females are sterile. We determined that hus1 mutant flies are sensitive to hydroxyurea and methyl methanesulfonate but not to X-rays, suggesting that hus1 is required for the activation of an S-phase checkpoint. We also found that hus1 is not required for the G2-M checkpoint and for post-irradiation induction of apoptosis. We subsequently studied the role of hus1 in activation of the meiotic checkpoint and found that the hus1 mutation suppresses the dorsal-ventral pattering defects caused by mutants in DNA repair enzymes. Interestingly, we found that the hus1 mutant exhibits similar oocyte nuclear defects as those produced by mutations in DNA repair enzymes. These results demonstrate that hus1 is essential for the activation of the meiotic checkpoint and that hus1 is also required for the organization of the oocyte DNA, a function that might be independent of the meiotic checkpoint.
Introduction
In many cell types specific checkpoint mechanisms exist that monitor the integrity of the chromosomes. These checkpoints coordinate cell cycle progression with DNA repair to ensure the distribution of accurate copies of the genome to daughter cells. If left unrepaired, chromosomal lesions can lead to genomic instability, a major contributing factor in the development of cancer and other genetic diseases. The DNA damage checkpoint response system involves a signal transduction pathway consisting of sensors, transducers and effectors (Dasika et al., 1999; Zhou and Elledge, 2000). Damaged DNA is initially sensed by a complex consisting of Hus1, Rad1 and Rad9 and the associated protein Rad17. Computer modeling suggests that Rad9, Hus1 and Rad1 (also called the 9-1-1 complex) form a doughnut-like heteromeric proliferating cell nuclear antigen (PCNA) complex that can be loaded directly onto damaged DNA (Rauen et al., 2000; Venclovas and Thelen, 2000; Bermudez et al., 2003). The signal transducers comprise four sets of conserved protein families. One family is composed of ATM and ATM-Rad3-related (ATR) proteins. Downstream of these proteins are two sets of checkpoint kinases, the Chk1 and the Chk2 kinases and their homologues. The fourth conserved family is that of the BRCT-repeat-containing proteins. Finally, a diverse range of effector proteins execute the function of the DNA damage response, which can lead to cell cycle arrest, apoptosis or activation of the DNA repair machinery (reviewed by Harrison and Haber, 2006).
A number of checkpoint proteins that were initially characterized in budding and fission yeast, have counterparts in Drosophila, Caenorhabditis elegans and mammals, demonstrating the conservation of these surveillance mechanisms. Several checkpoint proteins have been characterized in Drosophila, mainly the ATM and/or ATR and the Chk1 and/or Chk2 transducer family of proteins. An ATR homolog in Drosophila is encoded by mei-41 (Hari et al., 1995). mei-41 is essential for the DNA damage checkpoint in larval imaginal discs and neuroblasts and for the DNA replication checkpoint in the embryo (Hari et al., 1995; Brodsky et al., 2000; Garner et al., 2001). mei-41 also has an essential role during early nuclear divisions in embryos (Sibon et al., 1999). In addition, mei-41 plays important roles during meiosis, where it has been proposed to monitor double-strand-break repair during meiotic crossing over, to regulate the progression of prophase I, and to enforce the metaphase I delay observed at the end of oogenesis (Ghabrial and Schüpbach, 1999; McKim et al., 2000). Drosophila ATM and ATR orthologs are required for different functions. In Drosophila, recognition of chromosome ends by ATM prevents telomere fusion and apoptosis, by recruiting chromatin-modifying complexes to telomeres (Song et al., 2004; Bi et al., 2004; Silva et al., 2004; Oikemus et al., 2004). It has also been shown that dATM and mei-41 have temporally distinct roles in G2 arrest after irradiation (Song et al., 2004).
A Chk1 homolog in Drosophila is encoded by grapes (Fogarty et al., 1997). Similarly to mei-41, grapes is required to delay the entry into mitosis in larval imaginal discs after irradiation and to delay the entry into mitosis after incomplete DNA replication in the embryo (Sibon et al., 1997; Brodsky et al., 2000). The Drosophila Chk2 homolog [also designated loki (lok) or Dmnk] regulates multiple DNA repair and apoptotic pathways following DNA damage (Xu et al., 2001; Peters et al., 2002; Masrouha et al., 2003; Brodsky et al., 2004). It plays an important role in a mitotic checkpoint in syncytial embryos (Xu and Du, 2003) and is important in centrosome inactivation (Takada et al., 2003). Like Mei-41, DmChk2 also plays an important role in monitoring double-strand-break repair during meiotic crossing over (Abdu et al., 2002). Although our understanding of the role of DNA damage proteins is increasing, there is still a lack of information on the function of the Drosophila PCNA-like complex, 9-1-1.
In this study, we analyzed the interaction between the Drosophila Rad9, Hus1 and Rad1 proteins using a yeast two-hybrid assay. We were able to detect interaction between Hus1 and Rad9 or Rad1, but not between Rad9 and Rad1. We decided to focus our analysis on the meiotic and somatic requirement of Hus1. A null allele of hus1 was created by imprecise excision of a P element. We observed sensitivity of hus1 mutants to hydroxyurea (HU) and to methyl methanesulfonate (MMS) but not to X-ray irradiation. This implies that hus1 is required for the DNA replication checkpoint. The ability of a mutation in hus1 to suppress the eggshell polarity defects detected in mutants affecting double strand DNA repair enzymes demonstrates that it is required for the activation of the meiotic checkpoint that leads to a strong reduction in the translation of gurken mRNA. The similarity of the defects in the organization of the DNA in the oocyte nucleus between hus1 mutants and mutations in DNA repair enzymes suggest that hus1 may act upstream of the DNA repair machinery.
Results
Functional analysis of the Drosophila Hus1 gene
Studies in yeast and humans have shown that Rad9, Hus1, and Rad1 interact in a hetrotrimeric complex, which resembles a PCNA-like sliding clamp (reviewed by Parrilla-Castellar et al., 2004). To study the interaction between the Drosophila Rad9, Hus1 and Rad1 proteins, we performed a yeast two-hybrid assay (Fig. 1) in which Hus1 was used as a bait. Our results showed that Hus1 interacts with Rad9 and Rad1 to different degrees. Whereas Hus1 and Rad1 showed strong interaction (Fig. 1C2), only a weak interaction between Hus1 and Rad9 was detected (Fig. 1C1). To analyze the interaction between Rad9 and Rad1, Rad9 was used as bait. No interaction between Rad1 and Rad9 was found in this assay (data not shown).
Generation of null mutations in Hus1
We decided to focus our study on hus1, since there were several P-element lines available in hus1 gene region (Bellen et al., 2004). To analyze the somatic and meiotic requirements of the Drosophila Hus1, genetic studies were initiated. We screened for transposase-induced imprecise excisions by loss of the w+ marker and tested these lines by genomic PCR and DNA sequencing. Excision of the P transposon insertion, P{SUPor-P}KG07223, which is inserted 150 bases away from the 5′ end of hus1 (Bellen et al., 2004) yielded one candidate mutant, hus198. This line has deletion of 230 bases, which removes the first exon. RT-PCR analysis showed that removing the first exon had no effect on the level of hus1 transcript (data not shown). To create a null allele, another P-element transposon, {GT1}BG00590, which is inserted 2 kb from the 3′ of hus1 gene, was mobilized (Bellen et al., 2004) and one candidate mutant, hus137, was identified. hus137 has deletion of 3297 bases, which removes the entire ORF of the hus1 gene and deletes no other predicted transcript.
Since we were interested in understanding the role of the 9-1-1 complex in meiosis, the expression pattern of hus1, rad1 and rad9 genes during Drosophila oogenesis was studied. RT-PCR analysis showed that all three genes are expressed in Drosophila ovaries (Fig. 2A). However, no hus1 transcript was detected in hus137 ovaries by RT-PCR analysis, unlike wild-type ovaries (Fig. 2B), as expected from the molecular analysis, demonstrating that hus137 is a null allele. The level of Rad9 transcript was used as control (Fig. 2B). We found that hus137 mutant flies are viable, however, females are sterile. This line was used for further examination of hus1 mutant phenotypes.
hus137 mutant flies are sensitive to HU and MMS but not to X-rays
To examine a possible requirement for hus1 in somatic checkpoints in Drosophila, the sensitivity of hus137 mutants to varying concentrations of HU and MMS and to X-ray irradiation (2500 rad) was determined. HU stalls replication through inhibition of deoxynucleotide synthesis, MMS causes non-bulky adducts, which if not repaired by nucleotide excision repair or DNA base excision repair, result in DSB formation during replication, whereas X-rays cause a wide spectrum of DNA damage, including DSBs, throughout the cell cycle. Mutagen sensitivity is indicated by a decrease in the percentage of surviving homozygous flies in the irradiated cross progeny relative to unirradiated controls. We found that homozygous hus1 flies were sensitive to MMS and HU (Table 1 and 2). Exposure to 10 or 20 mM HU affected the survival of hus1 mutants, whereas treatment with 30 mM HU eliminated most of the hus1 homozygous class of progeny, indicating that hus1 mutant larvae are indeed highly sensitive to HU, presumably reflecting a requirement for hus1 activity in a fully functional DNA replication checkpoint. Similar results were also obtained when the hus1 allele was tested over a deficiency (Table 1). Interestingly, we found that hus1 mutants were highly sensitive to MMS. Relatively low doses of MMS (0.025%) caused almost 100% death of hus1 mutant flies. Similar results were also obtained when testing the hus1 mutation over a deficiency (Table 2). Most of the hus1 homozygous individuals died as larvae. When hus1 homozygous first and early second instar larvae were separated from their heterozygous siblings before MMS treatment using a GFP balancer chromosome, we found that only 19% (29/150) survived to pupal stages, whereas 75% of their heterozygous siblings (112/150) formed pupae. For both genotypes around 20% died as pharate adults.
Experiment 1 . | hus137/TM6B (% of total) . | hus137/hus137 (% of total) . | s.d. between experiments . | n . |
---|---|---|---|---|
Control | 65 | 35 | 4 | 438 |
HU 10 mM | 80 | 20 | 2 | 221 |
HU 20 mM | 88 | 12 | 6 | 213 |
HU 30 mM | 99 | 1 | 1 | 65 |
Experiment 1 . | hus137/TM6B (% of total) . | hus137/hus137 (% of total) . | s.d. between experiments . | n . |
---|---|---|---|---|
Control | 65 | 35 | 4 | 438 |
HU 10 mM | 80 | 20 | 2 | 221 |
HU 20 mM | 88 | 12 | 6 | 213 |
HU 30 mM | 99 | 1 | 1 | 65 |
Experiment 2 . | hus137/TM3 Df(hus1)/TM6 (%) . | hus137/Df(hus1) (%) . | s.d. between experiments . | n . |
---|---|---|---|---|
Control | 33 36 | 31 | NA | 128 |
HU 20 mM | 43 40 | 17 | NA | 120 |
Experiment 2 . | hus137/TM3 Df(hus1)/TM6 (%) . | hus137/Df(hus1) (%) . | s.d. between experiments . | n . |
---|---|---|---|---|
Control | 33 36 | 31 | NA | 128 |
HU 20 mM | 43 40 | 17 | NA | 120 |
HU, hydroxyurea. In the first set of experiments the larvae were derived from a cross between heterozygous hus137/TM6B parents; in the second experiment the larvae were derived from a cross of hus137/TM6B × Df(3R)110/TM3, Sb
NA, not applicable
Experiment 1 . | hus137/TM6B (%) . | hus137/hus137 (%) . | s.d. between experiments . | n . |
---|---|---|---|---|
Control | 47 | 53 | 4 | 771 |
MMS 0.025% | 97 | 3 | 2 | 362 |
MMS 0.05% | 98 | 2 | 6 | 192 |
MMS 0.08% | 100 | 0 | 1 | 121 |
Experiment 1 . | hus137/TM6B (%) . | hus137/hus137 (%) . | s.d. between experiments . | n . |
---|---|---|---|---|
Control | 47 | 53 | 4 | 771 |
MMS 0.025% | 97 | 3 | 2 | 362 |
MMS 0.05% | 98 | 2 | 6 | 192 |
MMS 0.08% | 100 | 0 | 1 | 121 |
Experiment 2 . | hus137/TM3 Df(hus1)/TM6 (%) . | hus137/Df(hus1) (%) . | s.d. between experiments . | n . |
---|---|---|---|---|
Control | 32 31 | 36 | NA | 358 |
MMS 0.08% | 52 46 | 2 | NA | 246 |
Experiment 2 . | hus137/TM3 Df(hus1)/TM6 (%) . | hus137/Df(hus1) (%) . | s.d. between experiments . | n . |
---|---|---|---|---|
Control | 32 31 | 36 | NA | 358 |
MMS 0.08% | 52 46 | 2 | NA | 246 |
MMS, methyl methanesulfonate. In the first set of experiments the larvae were derived from a cross between heterozygous hus137/TM6B parents; in the second experiment the larvae were derived from a cross of hus137/TM6B × Df(3R)110/TM3, Sb
Percentages are the fraction of total surviving adults
To determine potential causes of lethality after genotoxic stress, neuroblast squashes of MMS-treated larvae were examined for chromosomal defects. hus1 mutant larvae treated with 0.025% MMS had 15.4% aneuploid nuclei (Fig. 3B), an approximately fourfold increase as compared with wild-type larvae or their untreated siblings (Fig. 3A).
Treatment of hus137 with 2500 rad of irradiation did not result in a decrease of homozygous flies relative to untreated controls. Similar results were also observed when we tested hus137/deficiency (Table 3). In our irradiation assay we were able to detect a significant sensitivity of spn-B (spindle B) mutant flies (Table 4), which have been shown to be only moderately sensitive to irradiation (Staeva-Viera et al., 2003), indicating that hus1 mutant flies are not sensitive to irradiation.
Experiment 1 . | hus137/TM3 (%) . | hus137/hus137 (%) . | s.d. between days . | n . |
---|---|---|---|---|
Control | 65 | 35 | 9 | 2119 |
IR 2500 rads | 60 | 40 | 10 | 1869 |
Experiment 1 . | hus137/TM3 (%) . | hus137/hus137 (%) . | s.d. between days . | n . |
---|---|---|---|---|
Control | 65 | 35 | 9 | 2119 |
IR 2500 rads | 60 | 40 | 10 | 1869 |
Experiment 2 . | hus137/TM3 Df(hus1)/TM6 (%) . | hus137/Df(hus1) (%) . | s.d. between days . | n . |
---|---|---|---|---|
Control | 33 33 | 34 | 6 | 1830 |
IR 2500 rads | 37 25 | 38 | 5 | 674 |
Experiment 2 . | hus137/TM3 Df(hus1)/TM6 (%) . | hus137/Df(hus1) (%) . | s.d. between days . | n . |
---|---|---|---|---|
Control | 33 33 | 34 | 6 | 1830 |
IR 2500 rads | 37 25 | 38 | 5 | 674 |
IR, irradiation. In the first set of experiments the larvae were derived from a cross between heterozygous hus137/TM6B parents; in the second experiment the larvae were derived from a cross of hus137/TM6B × Df(3R)110/TM3, Sb
Percentages are the fraction of total surviving adults. Standard deviation shown is for percentage of hus137/Df(hus1) surviving flies
Treatment . | spnBBU/TM6B (%) . | spnBBU/spnBBU (%) . | s.d. between days . | n . |
---|---|---|---|---|
Control | 65 | 35 | 4 | 2355 |
IR 2500 rads | 81 | 19 | 5 | 827 |
Treatment . | spnBBU/TM6B (%) . | spnBBU/spnBBU (%) . | s.d. between days . | n . |
---|---|---|---|---|
Control | 65 | 35 | 4 | 2355 |
IR 2500 rads | 81 | 19 | 5 | 827 |
IR, irradiation. Larvae were derived from a cross between heterozygous spnBBU/TM6B parents
% are the fraction of total surviving adults
Hus1 is not required for the G2-M checkpoint and for post-irradiation induction of apoptosis
Following irradiation, a checkpoint is activated in the imaginal discs that results in a cell cycle arrest and the induction of apoptosis (Brodsky et al., 2000). Although hus1 is not required for survival after irradiation, Jaklevic and Su (Jaklevic and Su, 2004) have suggested that whereas DNA repair is essential for surviving irradiation, proper regulation of cell cycle and p53-dependent cell death is not essential for survival. grapes (chk1) is required for cell cycle arrest in the imaginal discs after irradiation and p53 is required for radiation-induced death, but flies mutant in either gene do not exhibit a significant decrease in survivorship after irradiation (Jaklevic and Su, 2004). Therefore, we tested for a requirement for hus1 in cell cycle arrest after irradiation by examining the phospho-histone H3 levels 1 hour post-irradiation. Similar to wild-type controls, in hus1 mutant discs very few mitotic cells were observed after irradiation (Fig. 4), indicating that cell cycle arrest is still correctly initiated. hus1 is also not required for the post-irradiation induction of apoptosis seen in wild-type discs. Four hours after irradiation, hus1 mutant discs exhibited wild-type levels of apoptosis (Fig. 5). For comparison, we also irradiated larvae that were homozygous mutant for mei-41. As previously reported (Jaklevic and Su, 2004), we also observed that cell division was not arrested in the mei-41 mutant. This result shows that the requirements for hus1 differ from those of mei-41 after IR.
The hus137 mutant suppresses the pattering defects caused by mutations in the DNA repair enzymes, but not the oocyte nuclear defects
Mutations in the spindle class of double-strand break (DSB) DNA repair enzymes, such as spn-A (RAD51), spn-B (XRCC3), spn-C (HEL308), spn-D (Rad51C) and okra (Dmrad54), affect dorsal-ventral patterning during Drosophila oogenesis and cause defects in the appearance of the oocyte nucleus (Ghabrial et al., 1998; Staeva-Vieira et al., 2003; Abdu et al., 2003; Laurencon et al., 2004). Interestingly, the defects in dorsal-ventral patterning and in the oocyte nucleus are dependent on the activation of a meiotic checkpoint (Ghabrial and Schüpbach, 1999; Abdu et al., 2002; Staeva-Vieira et al., 2003). Activation of the meiotic checkpoint prevents efficient translation of gurken (grk) mRNA, which results in a ventralization of eggs and embryos.
The patterning and the oocyte nuclear defects that occur as a result of mutations that affect double-strand DNA repair can be suppressed by blocking the formation of double-strand DNA breaks (DSBs) during meiosis using mutations in the topoisomerase mei-W68 (Ghabrial and Schüpbach, 1999) or by eliminating the checkpoint by using mutations in mei-41 and chk2 (Ghabrial and Schüpbach, 1999; Abdu et al., 2002; Staeva-Vieira et al., 2003). To study whether hus1 is required in the activation of the meiotic checkpoint due to unrepaired double-strand DNA breaks, flies double mutant for hus1 and spn-B or okra were generated. In double-mutant flies we observed suppression of the dorsal-ventral pattering defects as compared to the single mutants (Table 5). However, the oocyte nuclear defects were not suppressed by our null mutation in hus1 (Table 6). Interestingly, analyzing the organization of the oocyte nucleus DNA in the hus1 single mutant revealed similar oocyte nuclear defects (Table 6) as those produced by mutations in DNA repair enzymes. In hus1 mutants the DNA within the oocyte nucleus is found in a variety of conformations including the smooth spherical wild-type shape (Fig. 6A), oblong shape (Fig. 6B) or in several separate pieces along the nuclear periphery (data not shown) similar to the karyosome defects found in the spindle class of DNA repair enzyme mutations (Fig. 6D). Similar nuclear organization defects were obtained when the hus1 allele was tested over a deficiency (Fig. 6C). To demonstrate that the karyosome defects are due to the lack of the hus1 gene, we expressed the entire hus1 open reading frame using an actin-Gal4 driver line in a hus137 mutant background and found that this transgene fully rescues the karyosome defects (data not shown).
Maternal genotype . | Wild-type-like eggshell (%) . | Abnormal eggshell (%) . | n . |
---|---|---|---|
spn-BBU | 42 | 58 | 325 |
hus137 spn-BBU/spn-BBU | 55 | 45 | 458 |
hus137 spn-BBU | 99 | 1 | 652 |
okrAA | 49 | 51 | 321 |
okrAA/okrAA; hus137/TM6B | 65 | 35 | 254 |
okrAA/okrAA; hus137/hus137 | 99 | 1 | 677 |
Maternal genotype . | Wild-type-like eggshell (%) . | Abnormal eggshell (%) . | n . |
---|---|---|---|
spn-BBU | 42 | 58 | 325 |
hus137 spn-BBU/spn-BBU | 55 | 45 | 458 |
hus137 spn-BBU | 99 | 1 | 652 |
okrAA | 49 | 51 | 321 |
okrAA/okrAA; hus137/TM6B | 65 | 35 | 254 |
okrAA/okrAA; hus137/hus137 | 99 | 1 | 677 |
Wild-type-like eggshells have two separate dorsal appendages. Abnormal, ventralized eggshells have partially or completely fused appendages or lack appendages altogether
Maternal genotype . | Wild-type-like oocyte nucleus (%) . | Abnormal oocyte nucleus (%) . | n . |
---|---|---|---|
hus137 spn-BBU/spn-BBU | 2 | 98 | 88 |
hus137 spn-BBU | 1 | 99 | 74 |
okrAA/ okrAA; hus137/TM6B | 4 | 96 | 65 |
okrAA/ okrAA; hus137/hus137 | 3 | 97 | 87 |
hus137 | 8 | 92 | 121 |
Maternal genotype . | Wild-type-like oocyte nucleus (%) . | Abnormal oocyte nucleus (%) . | n . |
---|---|---|---|
hus137 spn-BBU/spn-BBU | 2 | 98 | 88 |
hus137 spn-BBU | 1 | 99 | 74 |
okrAA/ okrAA; hus137/TM6B | 4 | 96 | 65 |
okrAA/ okrAA; hus137/hus137 | 3 | 97 | 87 |
hus137 | 8 | 92 | 121 |
Discussion
In this study we analyzed the requirement of the Drosophila Hus1 protein in somatic and meiotic checkpoints. First, we analyzed the interaction of the 9-1-1 complex in a yeast two hybrid assay. We found that Hus1 interacted with Rad1 or Rad9, however no interaction between Rad1 and Rad9 was observed. The yeast two hybrid system may not be sensitive enough to pick up the interaction, since possibly the interaction between these two proteins is more transient than the interaction between Hus1 and the other proteins. Similar results were seen in C. elegans where these proteins interact in vivo (Hofmann et al., 2002).
Several studies have investigated the role of hus1 during development. In mouse, Hus1 is an essential gene, since its inactivation results in mid-gestational embryonic lethality due to widespread apoptosis. Also, loss of Hus1 leads to an accumulation of genome damage (Weiss et al., 2000). Both fission and budding yeast that lack hus1 fail to arrest the cell cycle after DNA damage or blockage of DNA synthesis (Enoch et al., 1992; Weinert et al., 1994; Kostrub et al., 1998). In C.elegans, although hus1 is not absolutely required for embryonic survival, a significant fraction of hus1 embryos die during embryogenesis, probably because of genomic instability. Also, hus1 mutants fail to induce apoptosis and proliferation arrest following DNA damage and show increased sensitivity to DNA damage-induced lethality (Hofmann et al., 2002). We found that the Drosophila hus1 is not an essential gene, although similarly to in C. elegans, the female mutants are sterile; this is probably due to the defects in the organization of the DNA within the oocyte nucleus.
In order to test for a requirement for Drosophila hus1 in response to genotoxic stress, we examined the survival rates of flies after exposure to HU, MMS and IR during larval development and found that hus1 mutant flies were sensitive only to HU and MMS. This result suggests that hus1 is required for the activation of an S-phase checkpoint. It is possible that this requirement is due to a role of hus1 in Chk1 (Grapes) activation after genotoxic stresses that affect S phase. In yeast and mice, hus1 has been shown to be required for Chk1 activation after replicative stress (Bao et al., 2004; Weiss et al., 2003) In Drosophila, mutations affecting grapes and mei-41 fail to show a decrease in BrdU-staining after irradiation, indicating a defect in an S-phase checkpoint (Jaklevic and Su, 2004), and it would, therefore, seem likely that Hus1 signals to activate Grapes (Chk1) through Mei-41 during S phase. An increase in aneuploid nuclei in hus1 mutants after MMS treatment is consistent with a requirement for hus1 in the response to DNA damage caused during S phase as it has been suggested in budding yeast that spontaneous chromosome loss is primarily suppressed by functional S-phase checkpoints and not by G2-M checkpoints (Klein, 2001). Since the hus1 mutant still exhibits cell cycle arrest after irradiation, hus1 does not seem to be required for the G2-M checkpoint that is dependent on Mei-41. Rather, our data suggest that hus1 is only required for certain DNA damage situations, and not for the same spectrum as Mei-41.
Activation of a meiotic checkpoint, also known as the pachytene checkpoint, in response to the persistence of unrepaired DSBs appears to be a conserved regulatory feature common to yeast, worms, flies and vertebrates. However, a requirement for the 9-1-1 complex in activation of the meiotic checkpoint has only been demonstrated in budding yeast. It was found that mutations in the yeast Hus1 homologue, Mec3, and the Rad1 homologue, Ddc-1, abolish the pachytene checkpoint in budding yeast (Hong and Roeder, 2000). In Drosophila, mutations in the spindle class of double-strand break (DSB) DNA repair enzymes, such as spn-A (RAD51), spn-B (XRCC3), spn-C (HEL308), spn-D (Rad51C) and okra (Dmrad54), affect dorsal-ventral patterning in Drosophila oogenesis and cause defects in the appearance of the oocyte nucleus (Ghabrial et al., 1998; Staeva-Vieira et al., 2003; Abdu et al., 2003; Laurencon et al., 2004). Interestingly, the defects in dorsal-ventral patterning and in the oocyte nucleus are dependent upon activation of a meiotic checkpoint (Ghabrial and Schüpbach, 1999; Abdu et al., 2002; Staeva-Vieira et al., 2003). We found that hus1 mutants are able to suppress the dorsal-ventral defects but not the defects in the organization of the DNA within the oocyte nucleus. The suppression of the DV patterning defects of spn-B mutants demonstrates that during meiosis Hus1 is required for the meiotic checkpoint in response to persistent DSBs. This finding is interesting in light of the fact that hus1 mutants are not IR sensitive or defective in somatic checkpoints after irradiation. Either there is a fundamental difference between germline and somatic DSBs and DSB response machinery, or the non-DSB lesions created during irradiation that are not present during meiotic recombination serve as triggers for an alternative sensing mechanism that does not require hus1 and is therefore still able to activate a checkpoint mechanism. The inability of hus1 mutants to suppress the karyosome phenotype along with the hus1 mutant phenotype by itself, demonstrates that hus1 is required for the organization of the oocyte DNA, a function that might be independent of the meiotic checkpoint.
In this study we have shown that Drosophila Hus1 is required for both the meiotic and somatic DNA damage responses as well as demonstrating a novel role of Hus1 in the organization of the oocyte nuclear DNA. Whereas some of the functions of Hus1, such as binding to 9-1-1 complex members and an essential role in surviving genotoxic stress during S phase, appear to be conserved across the species studied so far, some Hus1 functions seem to be less conserved. In contrast to the findings in yeast, worms and mouse, fly Hus1 is not required for survival after irradiation. Finally, the karyosome defect of hus1 mutants demonstrates a role for Drosophila Hus1 in organizing the chromosomal DNA of the meiotic nucleus.
Materials and Methods
Drosophila strains
Oregon-R was used as the wild-type control. The following mutant and transgenic flies were used: spn-BBU (Ghabrial et al., 1998), okraAA (Ghabrial et al., 1998), mei-41D3 (Hari et al., 1995) and chk2P6 (Abdu et al., 2002), Df(3R)110 (Bloomington stock center), P{GT1}BG00590 and P{SUPor-P}KG07223 (Bellen et al., 2004). Marker mutations and balancer chromosomes are described in the Drosophila Genome Database at http://flybase.bio.indiana.edu.
Yeast two hybrid
The two-hybrid screen was performed using the Hybrid Hunter System (Invitrogen). The entire coding sequence of Hus1 was amplified by PCR using modified primers to create an XhoI restriction site at the 5′ end and a SalI site at the 3′ end. The resulting PCR product was cut using XhoI and SalI and was cloned into the pHybLex/Zeo vector (LexA DBD, which was used as bait). The entire coding sequence of Rad1 as well as a truncated version (from amino acid 35) was introduced into the pYESTrp2 vector (B42 AD, which was used as prey) as SacI-EcoRI. The entire coding sequence of Rad9 was cloned into the pYESTrp2 vector as HindIII-EcoRI, and also cloned into the pHybLex/Zeo vector as SacI-XhoI. Positive interactions were detected by selecting on SD-His plates, followed by a second screen for β-galactosidase expression.
RT-PCR analysis
Total RNA was obtained from 10-15 ovaries using Trizol Reagent® (Invitrogen) following the manufacturer's protocol. RT-PCR was performed using SuperScript™ One-Step RT-PCR with Platinum® Taq (Invitrogen). Control experiments, using Platinum® Taq minus RT, were performed to confirm the absence of contaminating genomic DNA. No signal was ever obtained from the RNA preparation. The primers used were: (1) Rad1 forward GGATGACTGATGTGGAGCCATC and reverse CAGGGGATCGCCCTTATCCCTG, (2) Hus1 forward GCCTCGGTGCTTACGTCGTCTTCAAC, reverse ACATACAAACAGCTGGCAGAATAG and (3) Rad9 forward TTGCCAATGAAATACACTTTAG, reverse CCACGGATTATATTCGGCATC.
Transgenic flies
To make the pUASp-Hus1 fusion construct the entire coding sequence of hus1 was amplified by PCR using modified primers to create a KpnI restriction site at the 5′ end and a NotI site at the 3′ end. The resulting PCR product was cut using KpnI and NotI and was cloned into pUASp. P-element-mediated germline transformation of this construct was carried out according to standard protocols (Spradling and Rubin, 1982). Hus1 was expressed in the ovaries using an Act5C-Gal4 expression system.
DNA staining of ovaries
For karysome staining, ovaries were dissected in phosphate-buffered saline (PBS), fixed in 200 μl 4% paraformaldehyde in PBST (PBS + 0.2% Tween 20) plus 600 μl heptane for 20 minutes. Ovaries were incubated in 0.2 mg/ml RNase A and 3% BSA for 1 hour, washed and incubated in a 1:5000 dilution of OliGreen (Molecular Probes) or 1:10,000 Hoechst (Molecular Probes) and 1 μg/ml wheat-germ agglutinin-488 (Molecular Probes) for 1 hour. After several washes, ovaries were mounted in 50% glycerol:PBS and visualized by confocal microscopy.
Creation of hus1 mutants
Excision of P{SUPor-P}KG07223 was generated by crossing to a transposase-expressing line (Sb Δ2-3/TM6B). Seventy male progeny from this cross, of the genotype w; KG07223/Sb Δ2-3, were then crossed to Pri/TM6B females, and 145 potential excision events were identified by the loss of the w+ marker. All of these lines were tested by genomic PCR reaction with primers that cover the first exon. Excision of P{GT1}BG00590 was done as described above with the following modification: 167 potential excision events were identified and tested by genomic PCR reaction with primers that cover the second exon.
MMS, HU and IR sensitivity assays
Heterozygous males and females were mated in vials, and eggs were collected for 24 hours at room temperature. Parents were removed and 24-48 hours later the larvae were treated with different concentrations of methyl methanesulfonate (MMS; Sigma) or hydroxyurea (HU; Sigma), or irradiated (IR) with 2500 rad in a Faxitron X-ray cabinet. Control flies were treated with 250 μl water or not irradiated. After eclosion the percentage of mutant flies was determined, and the sensitivity was expressed as the fraction of the expected percentage of the mutant flies in the treated vial as compared to the progeny in untreated control vials. Each experiment was repeated at least three times.
Survival rates of hus1 larvae and pupae
First and early second instar larvae [age: 30 (±12) hours after egg laying] of appropriate genotype were selected under a dissecting microscope with a GFP detection filter. The larvae were put into food vials and treated with 0.08% MMS 4-6 hours later. Control larvae were treated with 250 μl water. White non-motile pupae were counted, then later, pharate adults, and finally, hatched adults were counted.
Checkpoint and apoptosis assays
Homozygous hus137 and mei-41D3 larvae were tested for their ability to undergo cell cycle arrest after IR as described by Brodsky et al. (Brodsky et al., 2000). Confocal stacks of 0.5 μm intervals were analyzed using Volocity 3DM software (Improvision). At least five discs from two separate experiments were used for quantification.
To determine the requirement for hus1 in post-irradiation induction of apoptosis during larval development, climbing homozygous larvae were mock-treated or treated with 4000 rad. Four hours after irradiation, imaginal discs were dissected, incubated in 0.5 μg/ml Acridine Orange for 5 minutes, washed in PBS, and visualized with a fluorescence microscope. Representative discs are shown from one of three replicate experiments. At least five discs were analyzed per experiment.
Neuroblast chromosome squashes
Larva were treated with water or 0.025% MMS as described for MMS sensitivity assays. Four to five days after MMS treatment larval brains of climbing third instar larvae were dissected in PBS and incubated in 20 μg/ml colchicine in PBS for 1 hour. Brains were incubated in 0.5% sodium citrate for 10 minutes, fixed in 11:11:2 acetic acid:methanol:water, and squashed in 45% acetic acid. Slides were frozen in liquid nitrogen, incubated for 20 minutes in cold ethanol and mounted in Vectashield mounting medium with DAPI (Vector).
Acknowledgements
We thank Itai Opatovsky for help with the yeast two-hybrid assays. We also thank Joe Goodhouse for help with confocal imaging and analysis, Daryl Gohl for help with the chromosome squashes and Lihi Gur Arie for the help with the transgenic flies. This work was supported by a Research Career Development Award from the IsraelCancer Research Fund to U.A., the Howard Hughes Medical Institute and by NIH grants PO1 CA41086 to T.S., and a New Jersey Commission on Cancer Research Fellowship to M.K.