Article Figures & Tables
Figures
- Table 1.
Strains used
Strain Relevant genotype References BF264-15Du MATa bar 1 leu2 ura3 trp 1 his2 ade 1 Richardson et al., 1989 MNY256 MATa bar 1 CLB2-GFP2X::KANR This study MNY246 MATa bar 1 ura3:: HIS3p:TUB1-CFP::URA3 This study MNY312 MATa bar 1 ura3::SPA2-GFP::URA3 This study MNY252 MATa bar 1 bud3::TRP 1 This study MNY313 MATa bar 1 bud3::TRP 1 ura3::SPA2-GFP::URA3 This study MNY314 MATa/α BUD3/BUD3-CFP::TRP 1 This study MNY264 MATa bar 1 bud3Δ1221::TRP 1 This study DHY 45 MATa ade2 can 1 his3 leu2 ura3 SPC29-CFP::KAN YRC Microscopy Y524 S288cMATa ura3 leu2 his3 lys2 ade2 trp 1 cdc12-1 Barral et al., 1999 - Table 2.
Oligonucleotides primers used in this study
Name Sequence clb2-0*† 5′-GGATCCTATAGATGTCCAACCCAA-3′ clb2-1* 5′-CGCGGATCCGAATTCATGAGTGAAACTGATAGTGGA-3′ clb2-2* 5′-CGCGGATCCGAATTCATGGACCTAGATGCAGAAGATGT-3′ clb2-3* 5′-CGCGGATCCGAATTCATGAATATTCATCAAAATCGAGATATC-3′ clb2-4* 5′-CGCGGATCCTCAGCGGCCGCCATGCAAGGTCATTATATCAT-3′ clb2-9† 5′-GCGCTCGAGTTCGGTATTTCTAACTTGAAGTTGACT-3′ clb2-10† 5′-GCGGTCGACCTAGATGCAGAAGATGTAAATGATCCA-3′ clb2-F/A‡ 5″-CATCGGATTGGGATAATTTAGGTTAGCTTTCAATGTCTTTAAAATG-3′ clb3-1§ 5′-CGCAGATCTGAATTCAAAATGCATCATAACTCACAGTC-3′ clb3-2§ 5′-CGCAGATCTTCCGGGTTGGGTTTATACAGGTC-3′ clb3-3§ 5′-CGCGGATCCGGATAAACAACCAGAGTTAAGA-3′ clb3-4§ 5′-CGCGAATTCAGCGGCCGCTGTTAGATCTTTCTACTCTGTG-3′ bud3-1¶ 5′-TTACGTGTTCGGGCTCTTATCTGGTTGCTAAAAGAGTATATTTACACCTCACCACGGATCCCCGGGTTAATTAA-3′ bud3-2¶ 5′-AATGTATACATTGCATTAAATTAAAAAGAAAAAAAAAATCAATAAAACACGAATTCGAGCTCGTTTAAAC-3′ bud3-3¶ 5′-TGGGAAACAGAACTGCGCTGTTGGTGGCCCAGAGAAACTGAAATTTTATCGGATCCCCGGGTTAATTAA-3′ Bud3-4** 5′-GCGCCGCCAGCTTCAAAAATTAACTTTCAAAGGTCACCATCCTATATTCGGATCCCCGGGTTAATTAA-3 ′ Bud3-5** 5′ATAATGGGCATCATGCTTATCTAAAACCACCCTCATTCCTTGAAAGAGGAATTCGAGCTCGTTTAAAC-3 ′ -
↵* Primers used for PCR amplification of truncated mutants of CLB2 (Δ132, Δ176, Δ213, Δ255). Underlined nucleotides correspond to restriction sites used for cloning into the pMJ200 vector and pRS316GAL1-HA3.
-
↵† Primers used for the construction of the Δ176-213 internal deletion of CLB2. Underlined nucleotides correspond to the restriction sites used for the internal fusion (clb-9 and clb-10) and for cloning into the pMJ vectors and pRS316GAL1-HA3 (clb2-0 and clb2-14 or clb2-4).
-
↵‡ Primers used for F354/A in vitro mutagenesis. Underlined nucleotides correspond to introduced mutations.
-
↵§ Primers used for amplification of CLB3 full-length, C-ter and N-ter domains. Underlined are restriction sites for chimeras construction and cloning into pMJ300, and pRS316GAL1-HA3.
-
↵¶ Primers used for PCR-based BUD3 deletion (1 and 2) and CFP tagging (3 and 2).
-
↵** Primers used for PCR-based construction of the bud3Δ1221 allele.
-
- Fig. 1.
Mitotic cyclin localization. (A) Localization of the Clb1, Clb2, Clb3 and Clb4 mitotic cyclins. The indicated mitotic cyclins were expressed as GFP fusions under the control of the GAL1 promoter. Cells grown in SC-raffinose were collected on nitrocellulose filters and induced for 3 hours on YEP-galactose plates before microscopic observation. (B,C) Clb2 localizes both on the spindle pole bodies and along the mitotic spindle. Cells expressing Spc29-CFP and Clb2-YFP or Tub1-CFP and Clb2-YFP are shown. CLB2-YFP was overexpressed from the GAL1p as described below. The left hand column is YFP, the center column is CFP and the right hand column shows merged YFP/CFP. (D) Localization of chimeras between Clb2 and Clb3. Cellular localization of the chimeras fused to GFP is shown. Galactose induction of the GFP-fused chimeras was achieved as described in A.
- Fig. 3.
Localization of truncated forms of Clb2. (A) Construction of truncated forms of Clb2. Positions of truncations and internal deletion are shown relative to the cyclin fold of Clb2 (started at residues 259). (B) Cdc28 binding and activation properties of truncated Clb2 mutants and chimera. Wild-type cells were transformed with a control vector or indicated constructs allowing expression of HA-tagged protein from the GAL1 promoter and grown in SC-ura raffinose medium. Expression of the HA-tagged proteins was induced by addition of 2% galactose for 3 hours. Cell lysate were processed for immunoprecipitation with anti-HA antibodies. Clb2-HA (top panel) and Cdc28 (middle panel) in the immunoprecipitates were assayed by western blotting with anti-HA and anti-PSTAIRE antibodies respectively. The bottom panel shows an autoradiogram of the Clb2-associated histone H1 kinase activity present in the immunoprecipitates. (C) Bud neck localization of the truncated forms of Clb2. To make the comparison more accurate, the proportion of bud neck staining was estimated only in large budded cells with separated nuclei, a stage where the staining is best visualized with the wild-type protein. At least 150 cells were counted for each strain. (D) Cellular localization of truncated mutants fused to GFP. Expression of the GFP-fusion proteins from the GAL1 promoter was as described in Fig. 1.
- Fig. 2.
Clb2-GFP shows similar localization when expressed from its endogenous promoter. 15Du haploid cells in which two GFP tags were introduced in tandem at the CLB2 chromosomal locus were grown to midlog phase in YPD supplemented with 45 μg/ml adenine. Each frame was generated by projecting processed images (Hyugens software, Bitplane) of four focal planes taken at 0.15 μm intervals through the cell. Exposure times were 3 seconds for each plane, to be compared to a mean exposure time of 500 mseconds when the Clb2-GFP fusion is overexpressed.
- Fig. 4.
Cdc28 binding activity and cellular localization of Clb2 mutants. (A) Cells were transformed with a control vector or the indicated constructs to direct expression of HA-tagged proteins under the control of the GAL1 promoter. Transformants were grown in SC-ura raffinose medium, arrested in M phase with nocodazole (15 μg/ml) for 2 hours before induction of protein expression by 2% galactose for 3 hours. Nocodazole arrest was used to avoid potential bias due to differences in cell cycle progression upon overexpression of the various Clb2 mutants. Cells were processed for immunoprecipitation with anti-HA antibodies and the immunoprecipitates were analyzed for their content of Clb2-HA and Cdc28 by western blotting and for H1-kinase activity (IP) as described in Fig. 3. Aliquots of the total extracts were also assayed for Clb2-HA and Cdc28 (TE). (B) Proportion of bud neck staining was estimated as described in Fig. 2. (C) The Clb2KA,EA,FA mutation was expressed from the GAL1 promoter as GFP-fusion proteins and its cellular distribution followed by fluorescence microscopy as described in Fig. 1. (D) Cellular localization of Clb2-hpm, Clb2Δ176-213, Clb2Δ176-213-hpm mutants fused to GFP.
- Fig. 5.
Role of Bud3 in targeting Clb2 to the neck. (A,B) Localization of Clb2-GFP fusion protein expressed from the GAL1p promoter in 15DU haploid cells harboring a deletion of the BUD3 gene or expressing a truncated form of Bud3 (bud3Δ1221). The double ring labeling observed in wild-type cells is almost completely abolished in Δbud3 cells although some cells (about 25%) show a faint single band at the bud neck junction. In contrast, the BUD3 gene is not required for proper cell cycle-regulated localization of Hof1 to the mother-bud neck. (C) Clb2 localization to the neck depends on septin integrity. Cells were grown in SC raffinose at 22°C. Half of the culture was shifted to the restrictive temperature (37°C) for 2 hours and then induced for 3 hours on YEPGal plates prewarmed at the same temperature. The proportion of cells exhibiting bud neck staining was estimated in large budded cells with separated nuclei by microscopic observation and counting. At least 150 cells were counted for each strain and condition. (D) Clb2-YFP colocalizes with Bud3 at the mother-bud neck. CLB2-YFP was overexpressed from the GAL1p in a 15DU diploid strain in which a CFP tag was appended to the C terminus of one copy of the BUD3 gene. The left hand column shows YFP, the center column shows CFP and the right hand column shows merged YFP/CFP signals.
- Fig. 6.
Cytokinesis is delayed in Δbud3 and bud3Δ1221 cells. (A) Cells (15DU, MNY252, MNY264) were arrested with 60 ng/ml α-mating factor for 2 hours and released synchronously at 25°C. Aliquots were taken every 15 minutes and DNA content analyzed by flow cytometry. (B) The proportion of cells entering a second round of budding before cell separation (arrow) was scored at the indicated times. (C,D) Cells were synchronized as in A but a second cell cycle was prevented by adding back 60 ng/ml α-factor at t75 min. The percentage of binucleate cells (C) and budded cells (D) was determined microscopically after a brief sonication.
Article navigation
Related articles
Cited by...
More in this TOC section
Similar articles
Other journals from The Company of Biologists
Cell scientist to watch: Janet Iwasa
Read our interview with molecular animator Janet Iwasa, where she talks about her transition from the wet lab, explains how animation can facilitate research and discusses the challenges of the field.
New funding scheme supports sustainable events
As part of our Sustainable Conferencing Initiative, we are pleased to announce funding for organisers that seek to reduce the environmental footprint of their event. The next deadline to apply for a Scientific Meeting grant is 26 March 2021.
Mole – The Corona files
“Despite everything, it's just incredible that we get to do science.”
Mole continues to offer his wise words to researchers on how to manage during the COVID-19 pandemic.
JCS and COVID-19
For more information on measures Journal of Cell Science is taking to support the community during the COVID-19 pandemic, please see here.
If you have any questions or concerns, please do not hestiate to contact the Editorial Office.