Skip to main content
Advertisement

Main menu

  • Home
  • Articles
    • Accepted manuscripts
    • Issue in progress
    • Latest complete issue
    • Issue archive
    • Archive by article type
    • Special issues
    • Subject collections
    • Cell Scientists to Watch
    • First Person
    • Sign up for alerts
  • About us
    • About JCS
    • Editors and Board
    • Editor biographies
    • Travelling Fellowships
    • Grants and funding
    • Journal Meetings
    • Workshops
    • The Company of Biologists
    • Journal news
  • For authors
    • Submit a manuscript
    • Aims and scope
    • Presubmission enquiries
    • Fast-track manuscripts
    • Article types
    • Manuscript preparation
    • Cover suggestions
    • Editorial process
    • Promoting your paper
    • Open Access
    • JCS Prize
    • Manuscript transfer network
    • Biology Open transfer
  • Journal info
    • Journal policies
    • Rights and permissions
    • Media policies
    • Reviewer guide
    • Sign up for alerts
  • Contacts
    • Contact JCS
    • Subscriptions
    • Advertising
    • Feedback
    • For library administrators
  • COB
    • About The Company of Biologists
    • Development
    • Journal of Cell Science
    • Journal of Experimental Biology
    • Disease Models & Mechanisms
    • Biology Open

User menu

  • Log in

Search

  • Advanced search
Journal of Cell Science
  • COB
    • About The Company of Biologists
    • Development
    • Journal of Cell Science
    • Journal of Experimental Biology
    • Disease Models & Mechanisms
    • Biology Open

supporting biologistsinspiring biology

Journal of Cell Science

  • Log in
Advanced search

RSS   Twitter  Facebook   YouTube  

  • Home
  • Articles
    • Accepted manuscripts
    • Issue in progress
    • Latest complete issue
    • Issue archive
    • Archive by article type
    • Special issues
    • Subject collections
    • Cell Scientists to Watch
    • First Person
    • Sign up for alerts
  • About us
    • About JCS
    • Editors and Board
    • Editor biographies
    • Travelling Fellowships
    • Grants and funding
    • Journal Meetings
    • Workshops
    • The Company of Biologists
    • Journal news
  • For authors
    • Submit a manuscript
    • Aims and scope
    • Presubmission enquiries
    • Fast-track manuscripts
    • Article types
    • Manuscript preparation
    • Cover suggestions
    • Editorial process
    • Promoting your paper
    • Open Access
    • JCS Prize
    • Manuscript transfer network
    • Biology Open transfer
  • Journal info
    • Journal policies
    • Rights and permissions
    • Media policies
    • Reviewer guide
    • Sign up for alerts
  • Contacts
    • Contact JCS
    • Subscriptions
    • Advertising
    • Feedback
    • For library administrators
Research Article
Disrupting polycystin-2 EF hand Ca2+ affinity does not alter channel function or contribute to polycystic kidney disease
Thuy N. Vien, Leo C. T. Ng, Jessica M. Smith, Ke Dong, Matteus Krappitz, Vladimir G. Gainullin, Sorin Fedeles, Peter C. Harris, Stefan Somlo, Paul G. DeCaen
Journal of Cell Science 2020 133: jcs255562 doi: 10.1242/jcs.255562 Published 24 December 2020
Thuy N. Vien
1Department of Pharmacology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Leo C. T. Ng
1Department of Pharmacology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jessica M. Smith
2Division of Nephrology and Hypertension, Mayo Clinic, Rochester, MN 55905, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ke Dong
3Departments of Internal Medicine and Genetics, Yale University School of Medicine, New Haven, CT 06510, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Matteus Krappitz
3Departments of Internal Medicine and Genetics, Yale University School of Medicine, New Haven, CT 06510, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Vladimir G. Gainullin
2Division of Nephrology and Hypertension, Mayo Clinic, Rochester, MN 55905, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sorin Fedeles
3Departments of Internal Medicine and Genetics, Yale University School of Medicine, New Haven, CT 06510, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Peter C. Harris
2Division of Nephrology and Hypertension, Mayo Clinic, Rochester, MN 55905, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Stefan Somlo
3Departments of Internal Medicine and Genetics, Yale University School of Medicine, New Haven, CT 06510, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Paul G. DeCaen
1Department of Pharmacology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Paul G. DeCaen
  • For correspondence: paul.decaen@northwestern.edu

Handling Editor: David Stephens

  • Article
  • Figures & tables
  • Supp info
  • Info & metrics
  • PDF + SI
  • PDF
Loading

ABSTRACT

Approximately 15% of autosomal dominant polycystic kidney disease (ADPKD) is caused by variants in PKD2. PKD2 encodes polycystin-2, which forms an ion channel in primary cilia and endoplasmic reticulum (ER) membranes of renal collecting duct cells. Elevated internal Ca2+ modulates polycystin-2 voltage-dependent gating and subsequent desensitization – two biophysical regulatory mechanisms that control its function at physiological membrane potentials. Here, we refute the hypothesis that Ca2+ occupancy of the polycystin-2 intracellular EF hand is responsible for these forms of channel regulation, and, if disrupted, results in ADPKD. We identify and introduce mutations that attenuate Ca2+-EF hand affinity but find channel function is unaltered in the primary cilia and ER membranes. We generated two new mouse strains that harbor distinct mutations that abolish Ca2+-EF hand association but do not result in a PKD phenotype. Our findings suggest that additional Ca2+-binding sites within polycystin-2 or Ca2+-dependent modifiers are responsible for regulating channel activity.

INTRODUCTION

PKD2 encodes for polycystin-2, a member of the polycystin subfamily of transient receptor potential ion channels (TRPP) (Venkatachalam and Montell, 2007). Previous work has established that polycystins form Ca2+-conducting channels in the primary cilia membrane of disparate tissues (DeCaen et al., 2013; Kleene and Kleene, 2012, 2017; Liu et al., 2018). Primary cilia are solitary projections that extend ∼5 μm from the apical side of cells. They are privileged cellular organelles comprising fewer than 500 unique protein components, and are found in all organ systems, including cells of the kidney nephron (Ostrowski et al., 2002; Pazour et al., 2005). Primary cilia house specific receptors and downstream effectors, which are capable of modulating morphogenic gene transcription responsible for left-right axis determination in developing vertebrate embryos (Braun and Hildebrandt, 2017; Mizuno et al., 2020; Nachury and Mick, 2019). Dysregulation of cilia- and centrosome-localized proteins results in ciliopathies – conditions that often affect specific organ systems but commonly share cystic kidney diseases as a comorbidity (Hildebrandt et al., 2011; Hildebrandt and Zhou, 2007). Variants in human PKD2 account for ∼15% of cases of autosomal dominant polycystic kidney disease (ADPKD) (Grantham, 2001; Mochizuki et al., 1996), a common ciliopathy that is characterized by progressive cyst development, which ultimately causes renal failure. ADPKD is proposed to be a recessive disease at the cellular level in which individuals inherit one variant polycystin allele and develop cysts after acquiring a second somatic mutation in the remaining allele (Koptides et al., 1999; Pei, 2001). Mouse models of attenuating Pkd2 expression by conditional genetic repression faithfully recapitulate the polycystic kidney phenotype (Happé and Peters, 2014; Ma et al., 2013; Wilson, 2008; Wu et al., 1998), whereas complete genetic deletion of Pkd2 causes embryonic lethality and kidney cyst development in utero (Menezes and Germino, 2013; Wu et al., 2000). These studies in mice suggest that most ADPKD-causing variants are loss of function, but our understanding of their mechanistic impact remains largely undetermined owing to their subcellular localization.

The primary cilium is electrochemically discrete from the cytosol, having its own depolarized membrane potential and resting concentration of Ca2+ (DeCaen et al., 2013; Delling et al., 2013). Analyzing polycystin-2 in primary cilia has opened opportunities to study its function under endogenous and heterologous expression conditions (Kleene and Kleene, 2017; Liu et al., 2018). Most recently, this methodology was used to determine that several disease-causing variants found in the human ADPKD population alter polycystin-2 gating without affecting its ciliary localization and tetramerization (Vien et al., 2020). Polycystin-2 forms a voltage-gated channel that opens at positive membrane potentials. As the cilia resting membrane potential is ∼−17 mV, most channels are closed until internal Ca2+ is elevated to micromolar concentrations (Delling et al., 2013). Once elevated, the voltage required to open polycystin-2 becomes hypopolarized and channel closure becomes incomplete at negative membrane potentials (Kleene and Kleene, 2017; Liu et al., 2018). In this article, we use the term ‘Ca2+-dependent modulation’ (CDM) to describe this form of polycystin-2 gating regulation. Importantly, this mechanism gives polycystin-2 gating its physiological relevance, allowing Ca2+ and monovalent ions to flow into the primary cilium at its resting membrane potential. Subsequently, prolonged and elevated intraciliary Ca2+ causes polycystin-2 channels to enter an irreversible non-conducting state, through a process we have termed ‘Ca2+-dependent desensitization’ (CDD). This form of polycystin regulation was postulated to protect the cell from Ca2+ overload, by turning off the flow of Ca2+ at the source within the ciliary compartment (DeCaen et al., 2013, 2016). Although CDD has been attributed to Ca2+ occupancy of the related polycystin-20-like 1 pore, the structural determinants responsible for CDD and CDM of polycystin-2 are unknown.

Besides primary cilia, polycystin-2 activity has been reported in the membranes of intracellular organelles (Koulen et al., 2002; Kuo et al., 2019). Polycystin-2 functionally mimics the Ca2+ response from bona fide endoplasmic reticulum (ER) ion channels, so its contribution is difficult to distinguish from inositol trisphosphate (IP3R)- and ryanodine receptor channel-mediated effects (Koulen et al., 2002; Qian et al., 2003; Vassilev et al., 2001). Measuring polycystin-2 in bilayers from reconstituted ER membranes is challenging, in part because it directly associates with IP3R (Santoso et al., 2011). Results from reconstitution and cytosolic Ca2+ assays have demonstrated that ER-localized polycystin-2 channels are responsive to intracellular Ca2+, and that mutations that remove the entire C-terminal domain (CTD), or alter the EF hand, abolish the entire function of the channel (Ćelić et al., 2012; Koulen et al., 2002). Partly based on this work, it was proposed that Ca2+ occupancy of its C-terminal EF hand is requisite for polycystin-2 channel function and Ca2+-dependent activation (Ćelić et al., 2012; Koulen et al., 2002; Petri et al., 2010; Yang and Ehrlich, 2016). However, these results have neither been validated from the ciliary pool of polycystin-2, nor have they provided a mechanistic description of the regulation of channel gating by Ca2+. In this study, we determined which EF hand vertices are most important for Ca2+ affinity. We found that disrupting Ca2+ occupancy of the EF hand did not alter CDM or CDD of the mouse and human orthologs of polycystin-2 in the primary cilia. We characterized the kidney phenotype from two new mice that express unique mutations that disrupt Ca2+-EF hand association but fail to develop polycystic kidney disease. We measured Gαq-mediated Ca2+ release from primary collecting duct cells isolated from wild-type and mutant mice to test ER-localized populations of polycystin-2, but found no difference. Our results suggest that Ca2+-dependent biophysical regulation of polycystin-2 involves other sites and/or effector proteins that control channel opening and desensitization. Our findings demonstrate that disruption of Ca2+-EF hand affinity does not lead to impaired in vitro or in vivo function of polycystin-2, which suggests that ADPKD-causing truncating variants found in the CTD likely affect other motifs that have a greater impact on channel regulation.

RESULTS

Two groups have independently reported that human and mouse orthologs of polycystin-2 are activated by internal Ca2+ using direct cilia electrophysiology (Kleene and Kleene, 2017; Liu et al., 2018). Polycystin-2 channels from both species are highly conserved and contain a C-terminal Ca2+-binding EF hand domain – a structural motif that is proposed to confer Ca2+ sensitivity in these channels (Ćelić et al., 2012; Mochizuki et al., 1996; Yang and Ehrlich, 2016). Although this motif has escaped structural determination in previously published cryogenic electron microscopy (cryo-EM) polycystin-2 structures, isolated EF hand(s) from human and sea urchin orthologs have been determined using crystallographic and nuclear magnetic resonance (NMR) methods (Allen et al., 2014; Petri et al., 2010; Yu et al., 2009). The EF hand of human polycystin-2 has five conserved vertices (X, Y, Z, -X and -Z) that coordinate the Ca2+ ion with four side chain carboxylate and one backbone carbonyl interactions (Fig. 1A,B). We isolated a CTD peptide of human polycystin-2 (I704-P797) that contains the EF hand, and measured changes in heat capacity upon Ca2+ addition using isothermal titration calorimetry (Fig. S1A). We determined that the affinity of Ca2+ for the wild-type human CTD EF hand was 19±5 µM – a finding which approximates the value previously reported (Kd=22 µM) for this peptide (Yang et al., 2015). Importantly, the polycystin-2 EF hand did not have affinity for other physiologically relevant divalent ions, Mg2+ and Zn2+ (Fig. S1B). We then individually mutated the EF hand vertices to alanine to determine which positions contribute to Ca2+ binding. We found that all five vertices are involved in Ca2+ affinity for the EF hand, as all alanine substitutions increased Kd 6–68× (Fig. 1B; Table S1). Based on these results, if Ca2+ occupancy of the EF hand regulates polycystin-2 function, disrupting its affinity for this motif should translate into measurable changes in the Ca2+-dependent properties of the channel.

Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1.

Disruption of Ca2 affinity for the polycystin-2 EF hand by single alanine substitutions and mouse model deletion and double mutations. (A) Structural alignment of two polycystin-2 channel structures solved using cryo-EM (PDBs: 5MKE in gray and 5T4D in light blue) (Shen et al., 2016; Wilkes et al., 2017). The hypothetical location of the unresolved internal CTD, which contains coiled-coil and EF hand motifs, is represented by a gray density. Inset, the human polycystin-2 EF hand structure solved by solution NMR (PDB: 2Y4Q, residues 721-793) with the Ca2+-coordinating vertices highlighted (Allen et al., 2014). (B) Top, an alignment of the human and mouse polycystin-2 EF hands. The locations of ADPKD-associated truncating frame shift variants are indicated by blue arrows. The location of the mouse model deletion (del-Z) and double alanine substitution (-X-Z) mutations used in this study are indicated. Bottom: calorimetry results measuring the differences in Ca2+-EF hand affinity when the coordinating vertices are substituted for alanine in the human CTD fragment (704-797). Average calculated Ca2+ affinity (Kd) from six replicates per peptide are graphed (data are mean±s.d.). Angled bar graph caps indicated that no affinity was detected from mutant EF hand fragments when tested up to 2 mM Ca2+.

To test whether Ca2+ occupancy of the EF hand is responsible for CDM and CDD of human polycystin-2, we generated double alanine mutations at the -X (T771A) and -Z vertices (E774A), which abolished Ca2+ affinity for the CTD fragment (Fig. 1B). We then expressed the -X-Z double mutation in PKD2-GFP in a PKD2null HEK cell line, so that exogenous channels could be assayed without the contribution of endogenous PKD2 alleles, as described previously (Vien et al., 2020). The stably expressed human wild-type and -X-Z channels trafficked to the primary cilia, and glass electrodes with submicron apertures were fabricated to form high resistance electrical seals with the GFP-illuminated cilia membranes (Fig. 2A; Movie 1). As described previously, we established inside-out cilia patch configurations so that Ca2+ within the cilia (intraciliary) can be adjusted by the superfusate (Fig. 2A,B) (Liu et al., 2018). We observed that the number of single channel events increased when intraciliary Ca2+ was elevated from 100 nM to 100 µM for both wild-type and -X-Z channels (Fig. 2B,C). However, no difference in Ca2+ potency (EC50) for opening between wild-type and mutant channels was observed after fitting the integrated single channel activity to the Hill equation (Fig. 2C; Table S2). Previous work has established that CDM is a product of a hypopolarizing-shift in the voltage dependence of polycystin-2, which increases channel open probability (Po) at negative membrane potentials (Kleene and Kleene, 2017; Liu et al., 2018). To determine whether this mechanism was altered by the -X-Z mutation, we compared voltage-dependent channel opening at low (100 nM) and high (100 µM) intraciliary Ca2+ concentrations (Fig. 3A). These experiments were performed with only one channel present in the membrane so that stochastic effects on single channel states could be determined. The shift in the voltage-dependence of half maximal open probability (▵V1/2) from low to high Ca2+ was −47 mV for wild-type channels, and was not different from the shift observed in -X-Z channels (Fig. 3B,C; Table S2). As reported previously, we observed that polycystin-2 enters an irreversible desensitized state (CDD) after prolonged exposure to high internal Ca2+ (Liu et al., 2018). To test the EF hand role in this form of channel regulation, we conducted whole-cilia recordings using 30 µM intraciliary free Ca2+ and plotted the time course of current desensitization (Fig. S2A,C). The time course of CDD was not different between wild-type and -X-Z mutant channels, as the magnitude of cilia current was completely abolished for both channels after 3.5 min of recording. Taken together, these results demonstrate that abolishing Ca2+ occupancy of the human polycystin-2 EF hand does not alter CDM and CDD forms of channel regulation.

Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2.

Intraciliary Ca2+ activates primary cilia currents conducted by wild-type and -X-Z polycystin-2 channels with similar potency. (A) Establishing high resistance seals with primary cilia in the inside-out configuration. Left: scanning electron micrograph images of a cilia patch electrode before (top) and after (bottom) fire polishing. Middle: images of a voltage-clamped primary cilia from an HEK cell expressing PKD2-GFP. Green fluorescence signal illuminates the cilia and intracellular compartments. Right: the tip of the cilia is lifted and torn from the cell to establish the inside-out configuration, in which intraciliary Ca2+ was exchanged in the perfusate. (B) Exemplar wild-type (WT) (left) or -X-Z (right) human polycystin-2 single channel currents recorded after exposure to increasing intraciliary Ca2+ while voltage clamped at 50 mV. Bottom: stochastic open channel events from the expanded time scale of the 100 µM Ca2+ condition. (C) The relationship of intraciliary Ca2+ and normalized integrated current from wild-type and -X-Z channels (n=8 cilia; data are mean±s.d.).

Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3.

Ca2+-dependent modulation of human polycystin-2 is unchanged after abolishing Ca2+-EF hand affinity using the -X-Z mutations. (A) Exemplar open channel events captured from inside-out patches with one channel in the cilia membrane. (B,C) Average channel open probability (Po) plotted as a function of voltage in the presence of 100 nM and 100 µM intracellular Ca2+. The data were fitted using the Boltzmann equation to estimate the half maximal voltage response (V1/2). Data are mean±s.d. (n=8 cilia recordings from each channel type).

Previous work disrupting polycystin-2 function by either allelic ablation or truncation of Pkd2 resulted in embryonic lethality for homozygous mice (Wu et al., 1998, 2000). Conditional and kidney-specific ablation of Pkd2 results in penetrant and reproducible polycystic kidney phenotype in mice (Ma et al., 2013). As the -X-Z mutation had no impact on polycystin-2 function, we hypothesized that homozygous animals expressing analogous mutations would likely survive, and the allelic impact of abolishing Ca2+ binding on cystogenesis in the kidney could be assessed in vivo. Furthermore, as the most sensitive bioassay for loss of polycystin function is cyst formation, we sought to determine whether the normal channel function without EF hand Ca2+ affinity is consistent with normal in vivo function by generating the equivalent -X-Z knock-in mouse model. To make the Pkd2-X-Z mouse, we employed the CRISPR/Cas9 method to replace the -X (T769A) and -Z (E772A) vertices, and simultaneously insert a V5 epitope tag immediately before the termination codon in murine Pkd2 (Tran et al., 2019). We confirmed expression of the mutated epitope-tagged protein in the kidney lysates by immunoblot analysis with an anti-V5 antibody (Fig. 4A). The animals were viable without developing either kidney or liver cysts up to 18 months (data not shown). Mice were systematically examined at 9 months of age, and exhibited normal kidney weight and liver weight as a fraction of body weight, and normal histological appearance without evidence of kidney tubular bile duct dilation or cyst formation (Fig. 4B-D). Pkd2+/− mice were crossed with Pkd2-X-Z/-X-Z animals to generate Pkd2-X-Z/Null mice to examine whether the reduced dosage could elicit a phenotype. These mice also did not display kidney or liver cysts at 9 months of age. The aggregate biophysical and in vivo results demonstrate that abolishing Ca2+-EF hand affinity using -X-Z vertices neutralizing mutations neither alters polycystin-2 ion channel function, nor engenders sufficient loss of function to cause polycystic kidney disease in mice.

Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4.

Pkd2-X-Z/-X-Z mice do not develop polycystic kidney or polycystic liver disease. (A) Immunoblotting with anti-V5 antibody showing the absence of epitope-tagged Pkd2 signal in wild-type kidney (red inverted triangle), and dose-dependent expression of Pkd2-V5 in Pkd2-X-Z/+ (blue square) and Pkd2-X-Z/-X-Z (black circle) kidney lysates. (B) Kidney-to-body weight ratio for 9-month-old wild-type (red inverted triangle), Pkd2-X-Z/+ (blue square), Pkd2-X-Z/-X-Z (brown triangle) and Pkd2-X-Z/null (black circle) mice. The P-value resulting from a one-way ANOVA statistical analysis is shown above the plot. The number of animals per genotype used are indicated within the parentheses. (C,D) Representative kidney scans (C) and hematoxylin and eosin (H&E) staining (D) of kidney sections (D, top row) and periportal liver sections (D, bottom row) from 9-month-old mice with the indicated (color coded) genotypes. Arrows indicate normal bile ducts; v, periportal vein. Scale bars: 100 µm (D, top row); 25 µm (D, bottom row).

This result excludes the hypothesis that Ca2+ occupancy of the EF hand is necessary for polycystin-2 function, and when disrupted, contributes to polycystic kidney disease (PKD). Thus, we challenged the robustness of this interpretation by generating a second mouse strain (Pkd2del-Z), in which the EF hand -Z vertex (E772), along with the preceding arginine (R771) were genetically deleted. Using isothermal titration calorimetry measurements, we confirmed that the del-Z mutation abolished Ca2+ occupancy of the EF hand (Fig. 1B; Fig. S1B). Pkd2+/del-Z, Pkd2del-Z/del-Z and Pkd2del-Z/- mice were viable to at least 12 months of age, and the kidney morphology of these mice was periodically imaged using MRI (Fig. 5A). As a positive control, we imaged the development of PKD cysts from cPkd2 mice, in which the expression of Pkd2 was attenuated by doxycycline induction after 6 months of life (Ma et al., 2013). Development of PKD-type kidney cysts was apparent in all (10/10) of the induced cPkd2 mice after one year, whereas none of the Pkd2+/+ (0/18), Pkd2+/del-Z (0/19) and Pkd2del-Z/del-Z (0/18) animals developed PKD-type cysts. In our preliminary observations, a minority of the Pkd2del-Z/del-Z (4/35) mice developed bilateral cystic disease (non-PKD-type), but because of the infrequency of this phenotype and because these cysts were not observed after outbreeding, we conclude that this bilateral cyst phenotype is not likely caused by the del-Z mutation. Owing to the limited resolution of MRI, we conducted histology experiments on sectioned kidneys from six mice from each genotype. Consistent with the MRI results, we did not observe any obvious cysts in the kidney sections from the other mice showing homozygous expression for Pkd2del-Z alleles (Fig. 5B). To quantify this observation, we conducted image analysis of the average number and size of cystoid foramen in the sections (Fig. 5C). All cPkd2 mice had significantly more and larger cystoids, whereas the sections isolated from mice expressing one or two copies of the Pkd2del-Z allele were not different from wild-type animals. Our results, generated from two mouse strains expressing unique mutations, demonstrate that abolishing Ca2+ affinity for the EF hand does not produce polycystic kidney disease in vivo.

Fig. 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 5.

Pkd2del-Z/del-Z mice do not develop polycystic kidney disease. (A) Exemplar MRI images of the frontal (top) and transverse (bottom) plane of the thoracic cavity of 12-month-old mice expressing the indicated Pkd2 genotypes. Kidney and liver cysts are visible in both planes obtained from conditional cPkd2 knockout animals (Pax8rtTA; TetO-cre; Pkd2fl/fl) 6 months after induction with doxycycline, as described previously (Liu et al., 2018; Ma et al., 2013). However, no obvious cysts were detected from mice expressing constitutive Pkd2del-Z alleles. (B) Top, exemplar black and white images of H&E-stained medial kidney sections. Bottom, FIJI analysis results were used to identify cystoid foramen (blue) after reverse-negative processing of the above images (Schindelin et al., 2012). (C) Box (s.e.m.) and whisker (s.d.) plots of the average diameter (left) and number (right) of foramen from kidney sections from 12-month-old mice (n=6 mice per genotype). Results from each individual mouse are indicated by open circles and the average for the geneotype is indicated by an x. P-values resulting from a one-way ANOVA statistical analysis are shown above the plots.

In our previous experiments, we established that the disruption of Ca2+-EF hand affinity does not alter the biophysical properties of the human ortholog of polycystin-2 under heterologous expression. To test these effects in murine primary collecting duct cells under native expression levels, we crossed the Pkd2del-Z mice with our cilia-specific reporter ARL13B-EGFP strain, in which all primary cilia become fluorescent under GFP excitation (DeCaen et al., 2013; Liu et al., 2018). We then isolated collecting duct cells (pIMCD) from Pkd2+/+, Pkd2+/del-Z and Pkd2del-Z/del-Z mice, and compared the CDM of polycystin-2 using the inside-out patch-clamp configuration. As expected, the voltage dependence of single channel opening for all three genotypes proportionally shifted to negative membrane potentials when internal Ca2+ was elevated, demonstrating that the CDM mechanism is still functional – a finding shared by our human channel results (Fig. S3). The half-maximal voltage-dependence of channel opening (V1/2) was not different from the three genotypes at low Ca2+. Under elevated intraciliary Ca2+, we observed a small but insignificant difference (−4 mV) in V1/2 when comparing the cilia channels measured from Pkd2+/+ and Pkd2del-Z/del-Z mice (Table S2). The potency of Ca2+ opening polycystin-2 channels was not different from Pkd2+/+ (EC50=1.2±0.4 µM), Pkd2+/del-Z (EC50=1.4±0.4 µM) and Pkd2del-Z/del-Z (EC50=1.4±0.3 µM) mice (mean±s.d.; Fig. S4, Table S2). In addition, we observed no difference in the onset of CDD between cilia currents recorded from Pkd2+/+ and Pkd2del-Z/del-Z mice (Fig. S2B,D). As discussed previously, polycystin-2 was reported to function as an intracellular Ca2+ release channel (Koulen et al., 2002). Here, vasopressin-stimulated Ca2+ release was attenuated by heterologous overexpression of a truncating mutation (L703X) in a porcine kidney-derived cell line (LLC-PK1). As L703X removes the EF hand along with the entire CTD in polycystin-2, it is conceivable that removing the EF hand motif was responsible for the attenuated Ca2+ response to vasopressin (Koulen et al., 2002). To determine whether Ca2+-EF hand occupancy might affect the function of the ER-localized population of polycystin-2, we compared Gαq-mediated Ca2+ store release from primary collecting duct cells isolated from Pkd2+/+ and Pkd2del-Z/del-Z mice (Fig. 6A-C). However, vasopressin- and carbachol-stimulated Ca2+ store release was indistinguishable between these genotypes, despite removing the affinity of Ca2+ for the EF hand using the del-Z mutation. Taken together, our results demonstrate that murine polycystin-2, in the ER and primary cilia membranes, is nominally impacted by the disruption of Ca2+-EF hand affinity, and this does not engender loss of function in vivo as it pertains to ADPKD.

Fig. 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 6.

Gαq-mediated Ca2+ release from ER stores are the same in collecting duct cells isolated from wild-type and Pkd2del-Z/del-Z mice. (A) An exemplar Ca2+-dependent Fura-2 emission ratio (340:380 nm) from primary cultures of pIMCD cells isolated from mice Pkd2+/+ mice. (B,C) Average cytosolic Fura-2 emission ratios from pIMCD cells isolated from Pkd2+/+ and Pkd2del-Z/del-Z mice before and after Gαq-mediated Ca2+ release using 800 nM arginine vasopressin (AVP) (B) or 50 µM carbachol (CCh) (C). The number of trials (N) and cells tested are listed per test group. Data are mean±s.d. P-values are indicated above the bar graphs (Student's t-test).

DISCUSSION

Many ion channels are regulated by intracellular Ca2+ – a feature which is tied to their physiological regulation in cell membranes. Like polycystin-2, the conductive properties of voltage-gated sodium (Navs) and Ca2+ channels (Cavs), and Ca2+-activated potassium channels (KCa) are modulated by internal Ca2+ (Xia et al., 2002; Chagot et al., 2009; Guo et al., 2016; Nejatbakhsh and Feng, 2011). Interestingly, all members of these channel families have C-terminal EF hands. However, there are clear differences in the involvement of this motif in their regulation by intracellular Ca2+. An example of a channel regulated by EF hand-Ca2+ association is the cardiac sodium channel, Nav1.5 (Wingo et al., 2004). Here, several missense variants associated with arrhythmia syndromes localize to the EF hand, which causes structural misfolding of the CTD and shifts Nav1.5 steady-state inactivation (Gardill et al., 2018). However, the EF hand is not solely responsible for Ca2+ regulation in these channels. Rather, the structural components of the Nav-Ca2+-sensing apparatus also include an ‘inactivation gate’ formed by their inter-domain loop motif and their CTD association with calmodulin – a ubiquitous, EF hand-containing Ca2+ sensor protein (Johnson et al., 2018; Shah et al., 2006; West et al., 1992). Conversely, inactivation of P/Q and L-type Cavs are structurally conferred by their CTDs, but mutations which disrupt EF hand-Ca2+ affinity do not alter this kinetic (Zhou et al., 1997), leading researchers to explore other potential sources of the Ca2+-sensing mechanism (DeMaria et al., 2001; Lee et al., 1999). Based on our findings, Ca2+ regulation of polycystin-2 appears to be an example of the latter, as our results clearly demonstrate that Ca2+-EF hand association is neither required for CDM or CDD, nor is it required for in vivo channel function as it pertains to ADPKD. How then does polycystin-2 sense Ca2+ and, in response, alter its gating? We hypothesize that Ca2+ is acting on an undetermined receptor site(s) within the channel, or that an unknown Ca2+-binding protein associates with polycystin-2 to regulate its gating. Results from calorimetry and NMR spectra methods suggest that the EF hand is the only Ca2+ binding site in the CTD of polycystin-2 (Yang et al., 2015). However, it is important to note that the complete channel protein was not tested in these studies and in our data set, which leaves the possibility that the remaining portion of the channel may contain additional Ca2+ coordinating sites. As the CDM can be observed in the inside-out patch configuration, our results suggest that Ca2+ is either acting directly, or involves an interacting ‘Ca2+-sensor’ protein that is not readily disassociated from the channel, such as a pre-associated effector protein or membrane embedded factor. This feature is observed in Nav, Cav and in the small (SK) and large-conductance Ca2+-activated K+ (BK) channels, in which separate Ca2+-sensor proteins bind to motifs within the channel to control gating (Ben-Johny and Yue, 2014; Fanger et al., 1999; Lee and MacKinnon, 2018; Wang et al., 2014). Polycystin-2 interacts with a number of different proteins; however, it is unknown whether their association is Ca2+ dependent (Morick et al., 2013; Sammels et al., 2010; Streets et al., 2010). Recently, calmodulin was reported to bind and regulate the function of polycystin-2-like 1 – but this relationship is undetermined for polycystin-2 regulation by any other Ca2+ effector proteins (Park et al., 2019). It is not clear whether there is one or perhaps multiple sites that regulate CDM and CDD in either polycystin. What is clear, is that Ca2+ affinity for the EF hand is dispensable for the function of polycystin-2 and polycystin-2-like 1 channels (DeCaen et al., 2016). Furthermore, selectively neutralizing the EF hand vertices responsible for Ca2+ affinity does not result in cystic kidney disease in mice. CDM and CDD are critical forms of channel regulation, which respectively turn ‘on’ and ‘off’ the flow of Ca2+ within the cilia and from the ER. Thus, future work elucidating the components and structural elements responsible will be critical for understanding polycystin-2 molecular regulation, which is demonstrably involved in ciliary function and the initiation of cystogenesis in ADPKD.

We have reported that the EF hand of polycystin-2 coordinates Ca2+ with low affinity (Kd=19 µM), in agreement with previous calorimetry studies (Ćelić et al., 2008; Yang and Ehrlich, 2016). This relatively weak affinity would seem irrelevant to ion channels of the plasma membrane, in which free Ca2+ (∼90 nM) is regulated by cytoplasmic buffering proteins. However, as the primary cilia retains a high concentration of Ca2+ (390-580 nM) at rest, and the EF hand motifs are near the ion-conducting pore, they are likely to experience elevated Ca2+ in the micromolar range (Delling et al., 2013). The CTD contains coiled-coil and EF hand motifs, which have structurally solved separately as fragments using crystallographic and NMR methods (Allen et al., 2014; Petri et al., 2010; Zhu et al., 2011). Previous work measuring Ca2+ release from ER-localized polycystin-2 has determined that truncating mutations, which also remove the EF hand, cause a complete loss of channel gating, possibly due to loss of Ca2+-channel affinity or lack of channel subunit oligomerization (Yang and Ehrlich, 2016; Yang et al., 2015). Although our work demonstrates that the abolishment of Ca2+-EF hand occupancy of polycystin-2 does not alter Ca2+-dependent regulation, the CTD in its entirety may still be involved in allosterically regulating the channel pore or its assembly. Based on the low resolution density maps used to solve the core structures of polycystin-2, the N- and C-terminal ends of the polycystin peptide form a multimeric structure on the internal side of the channel (Grieben et al., 2017; Shen et al., 2016; Wilkes et al., 2017). Although the contiguous CTD is not resolved either in the polycystin-2 homomeric channel structure or in its complex with polycystin-1 (Su et al., 2018), this site might be involved in controlling the opening of the lower gate through its interactions with the extended intracellular portion of the S6 helix. Our in vivo results demonstrate that two independent mouse models that harbor unique EF hand mutation types that abolish Ca2+ affinity do not manifest the polycystic kidney disease phenotype. Among ∼6000 ADPKD-associated sequences analyzed, there are no reported in-frame variants (missense, insertion and deletions) in the coding region of the PKD2 EF hand (https://pkdb.mayo.edu/; P.C.H., unpublished data). However, there are several reported frameshift variants, which result in premature truncations of the CTD (Fig. 1B). These clinical observations, in conjunction with our findings, suggest that mutations that remove the CTD will have greater impacts on polycystin-2 gating and result in PKD-type cystogenesis, whereas those that alter Ca2+ occupancy of the EF hand are likely benign.

MATERIALS AND METHODS

CTD protein expression, purification and isothermal titration calorimetry

The C-terminal fragment of human polycystin-2 (I704-P797) was cloned into the PET19b vector and transformed into BL21 (DE3) competent cells (New England Biolabs) for bacterial expression. The translated peptide has a 10× His tag on its N-terminus. Additionally, the alanine mutants of the individual Ca2+-coordinating residues were created and transformed. Cells were grown in 2× YT broth in a 37°C shaking incubator until OD600 reached ∼0.6, and were induced by 0.4 mM isopropyl 1-thio-β-D-galactopyranoside and grown for another 4 h. Cells were harvested and resuspended in buffer A (500 mM NaCl, 20 mM Tris-HCl, pH 7.4), 5% glycerol, 0.25 mM EDTA (pH 8.0), 1 mM PMSF (RPI), 25 µg/ml lysozyme and DNase I (GoldBio). The suspension was then lysed by sonication and clarified by centrifugation (30,000 g for 0.5 h). Filtered supernatant was loaded into a HisPur cobalt Superflow agarose column (Thermo Scientific). The column was washed with 10 column volumes (CV) of buffer A, 5 CV of buffer A plus 5 mM imidazole, and finally eluted with 3 CV of buffer A+100 mM imidazole. The eluate was desalted by dialysis in 150 mM NaCl, 20 mM Tris/HCl, 20 mM imidazole (pH 7.4). SDS-PAGE confirmed the expression, solubility and purity of the peptide. All of our solutions were formulated with ultrapure water (Milli-Q IQ 7005 water purification system), which has less than 0.29 ng/l Ca2+ ions present. The binding affinity was recorded based on the heat difference between the sample cell and reference cell measured by MicroCal iTC200. Forty successive additions of 1 µl CaCl2 (2 mM) were added into the sample cell containing 400 µM of the respective purified peptides at 1 min intervals. The cells were insulated by an adiabatic jacket held at 25°C. The heat of dilution of Ca2+ was not subtracted from data sets as the signal was prohibitively small for several of the mutant channels. The exothermic energy of the bimolecular interaction between Ca2+ and peptide during each injection was analyzed by integrating the change in heat to generate the binding isotherm. The resulting relationship was fit (Origin 7.0) with a one-site independent binding model to determine the binding affinity (Kd).

Production of the Pkd2-X-Z mouse strains and histology analysis

Signal guide RNAs (sgRNAs) for the T769A and E772A mutations (5′-GCTCACGCTCGGTCAGTTCC-3′) and the inserted V5 tag (5′-CACGTGTGGATTATTAGGCA-3′) were designed using the CRISPR Design tool (http://crispr.mit.edu/). To edit the mouse genome, single-stranded oligodeoxynucleotide (ssODN) donor templates for T769A and E772A point mutations, and another with a V5 tag in-frame at the C-terminus, were synthesized (IDT). A sgRNA plasmid was constructed and linearized, followed by in vitro transcription of sgRNAs using MEGAshortscript Kit (Invitrogen). The yield and quality of sgRNA were assessed by absorbance ratio and gel electrophoresis (Shen et al., 2014). In vitro transcribed sgRNAs, Cas9 protein (NEB) and two donor ssODN templates were microinjected into zygotes, followed by culture and transfer of blastocysts into the uterus of pseudopregnant ICR female mice (Horii et al., 2014; Wang et al., 2013). Founders were identified by PCR amplification of genomic DNA from tail biopsies, followed by sequencing of the PCR products (Shen et al., 2014). Genotyping of experimental mice was carried out using allele-specific PCR primers (capitalized) for the T769A and E772A double mutant (TCAAGAGCTTGCTGAACGAGC and tgtttaccaaggtcttgggcaagca) and wild-type alleles (CCAGGAACTGACCGAGCGTGA and tgtttaccaaggtcttgggcaagca).

Production of the Pkd2del-Z mouse strains, MRI and kidney histology analysis

The Pkd2del-Z mouse was generated using the CRISPR/Cas9 method with the guide RNA 5′-AAACAGCGTGAGCATCAACAGATGC-3′. To characterize their phenotype Pkd2+/+ (10 males and 8 females), Pkd2+/del-Z (10 males and 9 females) and Pkd2del-Z/del-Z (10 males and 8 females) were MRI scanned at 9 and 12 months of age. Nine-month-old cPkd2 mice (10 males and 8 females) were fed doxycycline through drinking water for 1 week to genetically attenuate Pkd2 expression (Pax8rtTA; TetO-cre; Pkd2fl/fl), as described previously (Liu et al., 2018; Ma et al., 2013). MRI imaging was conducted at the Northwestern University Center for Advanced Molecular Imaging using a Bruker BioSpec (9.4 Tesla). Mice were anesthetized and placed in a chamber containing 3% isoflurane, and their respiration was monitored for the duration of the scan (Irazabal et al., 2015). The kidneys from Pkd2+/+, Pkd2+/del-Z, Pkd2del-Z/del-Z and cPkd2 mice (10 mice each) were fixed in 40% paraformaldehyde for 24 h, sectioned on a cryostat, mounted on glass coverslips and stained with hematoxylin and eosin (H&E). Images of medial sections from both kidneys were analyzed using FIJI (ImageJ) to identify cystoid foramen. Images were processed as black and white, and reverse-negative. The images were then analyzed using the particle analysis search protocol, in which the lower limit threshold for circular foramen was set to 20 µm to identify cystoid foramen in the tissue samples. Pkd2del-Z mice were crossed with our previously established ARL13B-EGFP mouse, so that primary cilia could be visualized from living cells during our cilia electrophysiology recordings described in the next section (Liu et al., 2018). Animals were housed at AALAS certified facilities located at Yale University, Northwestern University and the Mayo Clinic. All animal procedures and protocols were approved by the Institutional Animal Care and Use Committees (IACUCs) of each university.

Cell culture of primary inner medullary collecting duct cells and immortalized cell lines

Primary inner medullary collecting ducts cells (pIMCD) were isolated from wild-type or Pkd2del-z/del-z mice co-expressing the ARL13B-EGFP cilia reporter, using a method described previously (Liu et al., 2018). Briefly, inner medullae were removed from the kidney and disassociated using a Dulbecco's PBS containing 2 mg/ml collagenase A and 1 mg/ml hyaluronidase. After mechanical disassociation on ice, medullary cells were cultured in Dulbecco's modified essential medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 units/ml penicillin and 100 μg/ml streptomycin. Cilia were patched from cells within 6 days after isolation, and within one passage. HEK PKD2Null cell lines were generated using the CRISPR/Cas9 gene editing kit available from Addgene and authenticated using PCR analysis, as described previously (Liu et al., 2018). To generate the stable cell lines expressing C-terminally tagged versions of wild-type and deletion mutants of human polycystin-2, the human (h)PKD2 gene was subcloned into the lentiviral pLVX-GFP-N1 (Clontech) vector using the Gibson assembly method. The del-Z deletion in hPKD2-GFP was generated using a modified site-directed mutagenesis protocol. Lentiviral infected cells were selected using culture medium containing puromycin (2 μg/ml), and sorted (BD FacsMelody) at 5000 to 10,000 counts per minute to enrich for the transgene expression. Stable cell lines were cultured in DMEM supplemented with 10% FBS and 100 units/ml penicillin, 100 units/ml streptomycin and 1 μg/ml puromycin selection antibiotic. On a monthly basis, mycoplasma testing (MycoProbe, R&D systems) was performed on all active cultures in our incubators.

Electrophysiology

The electrophysiologist was blinded by a third party in the laboratory, whereby test groups were assigned a letter to conceal the genetic identity of the cells being evaluated. The identity of the cells remained unknown by the electrophysiologist until the analysis was complete. Ciliary ion currents were recorded using borosilicate glass electrodes polished to resistances of 14-23 MΩ using the cilium patch method described previously (Vien et al., 2020). Single channel currents measured in the inside-out configuration were recorded in symmetrical sodium concentrations. All of our solutions were formulated with ultrapure water (Milli-Q IQ 7005 water), which has less than 0.29 ng/l Ca2+ ions present. The internal solution (bath) contained (in mM): 120 NaMES, 10 NaCl and 10 HEPES. Ca2+ was buffered with 5 EGTA, 5 Na4-BAPTA {Glycine, N,N′-[1,2-ethanediylbis(oxy-2,1-phenylene)]bis[N-(carboxymethyl)]-,tetrasodium} and 0.5 EDTA; free Ca2+ was calculated using Maxchelator and titration of 1 M CaCl2 solution (Bers et al., 2010); pH was adjusted to 7.3 using NaOH. Standard external solution (pipette electrode) contained 150 NaCl, 10 HEPES, 2 CaCl2; pH 7.4. All solutions were osmotically balanced to 300 (±7) mOsm with d-mannitol. Whole-cell currents used to measure CDD were also recorded in symmetrical sodium concentration, placing the internal recording solution in the pipette electrode and the external recording solution in the bath. Data were collected using an Axopatch 200B patch-clamp amplifier, Digidata 1550B and pClamp 10 software. Single channel currents were digitized at 50 kHz and low-pass filtered at 10 kHz. Intraciliary conditions were controlled using an Octaflow II rapid perfusion system (ALA systems) in which the patched cilia and electrode were held in the perfusate stream. Data were analyzed by Igor Pro 7.00 (Wavemetrics). The polycystin-2 open probability (Po) current-voltage relationships were fitted to a Boltzman equation, f(x)=1/(1+exp[V-V1/2]/k), to estimate the half-maximal voltage (V1/2) required to open the channels. The potency of Ca2+ opening polycystin-2 channels was estimated by integrating the single channel current measured in response to elevating the internal Ca2+ concentration ([Cain]). The average integrated current was fitted to the Hill equation, f(x)=base+(max-base)/{1+(EC50/[Cain]), to estimate the effective concentration of Ca2+ (EC50) required to half maximally stimulate the polycystin-2 response.

Intracellular Ca2+ measurements using Fura-2

Vasopressin-mediated intracellular Ca2+ responses were measured from pIMCD cells 24 to 72 h after cells were isolated. Before seeding the cells, glass-bottom dishes were pre-coated with poly-L-lysine and laminin (Sigma-Aldrich). The cells were incubated for 1 h at 37°C in complete medium after loading with 2 µg of Fura-2/AM (Invitrogen). The cells were then washed with and stored for 15 min in Tyrode's solution (in mM): 140 NaCl, 4 KCl, 2 MgCl2, 2 CaCl2, 10 Glucose and 10 HEPES. Cells were adjusted in pH to 7.4 with NaOH and osmolarity to 300 mOsm with d-mannitol. Cells were then placed under an inverted wide-field microscope equipped with a 20× objective lens (Olympus IX81), and the stage temperature was held at 37°C (Tokai Hit). Images of Fura-2 fluorescence remission at 520 nm were captured every 2 s during excitation at 380 nm (Ca2+ free) and 340 nm (Ca2+ bound). Images were acquired and analyzed using SlideBook (Intelligent Imaging Solutions), which synchronizes the filter wheel changer (Lambda 10-3, Sutter Instrument) and the camera (ImagEMX2, Hamamatsu). In each trial or replicate (n), the emission fluorescence (340:380 nm) ratio of 15 to 30 cells was recorded after subtracting the background fluorescence levels. This ratio was averaged at the start (for resting level) and the response was reported after extracellular vasopressin or carbachol treatment (for maximal response). At least three replicates (n) were performed with cells isolated from five animals of the same genotype.

Statistical analysis

Sample sizes were determined based on 2-sample t-test power analysis of the recorded variance from pilot study results from each assay, where target power=0.9 and α=0.05. Statistical comparisons were made using one-way ANOVA or two-tailed unpaired Student's t-tests using OriginPro software (OriginLab) or Excel (Microsoft). Experimental values are reported as the mean±s.d., unless otherwise stated. Differences in mean values were considered significant at P<0.05. All of our results are normally distributed as per a Shapiro–Wilk Test.

Acknowledgements

We thank members of the DeCaen, Somlo and Harris labs for their useful comments during the progress of this study.

Footnotes

  • Competing interests

    The authors declare no competing or financial interests.

  • Author contributions

    Conceptualization: T.N.V., L.C.T.N., P.C.H., S.S., P.G.D.; Methodology: T.N.V., L.C.T.N., S.S., P.G.D.; Validation: T.N.V., V.G.G., S.F., P.G.D.; Formal analysis: T.N.V., L.C.T.N., J.M.S., K.D., M.K.; Investigation: T.N.V., L.C.N., J.M.S., K.D., S.S.; Resources: V.G.G., P.D.; Data curation: T.N.V., L.C.TN., J.M.S., K.D., M.K., S.S.; Writing - original draft: T.N.V., L.C.T.N., P.G.D.; Writing - review & editing: T.N.V., L.C.T.N., J.M.S., P.C.H., S.S., P.G.D.; Supervision: M.K., S.F., P.C.H., P.G.D.; Project administration: P.C.H.; Funding acquisition: P.C.H., S.S., P.G.D.

  • Funding

    This work was supported by the National Institute of Diabetes and Digestive and Kidney Diseases (1R56DK119709-01, R00 DK106655, 1R01DK123463-01 and NU GoKidney George M. O'Brien Kidney Research Core Center grant, P30DK11485, to P.G.D.); the PKD Foundation Research Grant (to P.G.D.); the Mayo Clinic PKD Center Pilot and Feasibility Program grant (to P.G.D.); a Carl W. Gottschalk Research Scholar Grant from the American Society of Nephrology (to P.G.D.); the Mayo PKD Center, National Institute of Diabetes and Digestive and Kidney Diseases grants 5R01DK058816-19 and 5P30DK090728-10 (to P.C.H.); National Institute of Diabetes and Digestive and Kidney Diseases grant R01DK100592; and a Deutsche Forschungsgemeinschaft Forschungsstipendium fellowship (to M.K.), with core services provided by the George M. O'Brien Kidney Center at Yale (P30 DK079310). Deposited in PMC for immediate release.

  • Data availability

    Data files associated with this article are available through the Northwestern University institutional repository service: https://doi.org/10.21985/n2-yqyk-9937.

  • Supplementary information

    Supplementary information available online at https://jcs.biologists.org/lookup/doi/10.1242/jcs.255562.supplemental

  • Received October 8, 2020.
  • Accepted October 27, 2020.
  • © 2020. Published by The Company of Biologists Ltd
http://creativecommons.org/licenses/by/4.0

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed.

References

  1. ↵
    1. Allen, M. D.,
    2. Qamar, S.,
    3. Vadivelu, M. K.,
    4. Sandford, R. N. and
    5. Bycroft, M.
    (2014). A high-resolution structure of the EF-hand domain of human polycystin-2. Protein Sci. 23, 1301-1308. doi:10.1002/pro.2513
    OpenUrlCrossRefPubMed
  2. ↵
    1. Ben-Johny, M. and
    2. Yue, D. T.
    (2014). Calmodulin regulation (calmodulation) of voltage-gated calcium channels. J. Gen. Physiol. 143, 679-692. doi:10.1085/jgp.201311153
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Bers, D. M.,
    2. Patton, C. W. and
    3. Nuccitelli, R.
    (2010). A practical guide to the preparation of Ca2+ buffers. Methods Cell Biol. 99, 1-26. doi:10.1016/B978-0-12-374841-6.00001-3
    OpenUrlCrossRefPubMedWeb of Science
  4. ↵
    1. Braun, D. A. and
    2. Hildebrandt, F.
    (2017). Ciliopathies. Cold Spring Harb. Perspect Biol. 9, a028191. doi:10.1101/cshperspect.a028191
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. C´ elić, A.,
    2. Petri, E. T.,
    3. Demeler, B.,
    4. Ehrlich, B. E. and
    5. Boggon, T. J.
    (2008). Domain mapping of the polycystin-2 C-terminal tail using de novo molecular modeling and biophysical analysis. J. Biol. Chem. 283, 28305-28312. doi:10.1074/jbc.M802743200
    OpenUrlAbstract/FREE Full Text
  6. ↵
    1. C´ elić, A. S.,
    2. Petri, E. T.,
    3. Benbow, J.,
    4. Hodsdon, M. E.,
    5. Ehrlich, B. E. and
    6. Boggon, T. J.
    (2012). Calcium-induced conformational changes in C-terminal tail of polycystin-2 are necessary for channel gating. J. Biol. Chem. 287, 17232-17240. doi:10.1074/jbc.M112.354613
    OpenUrlAbstract/FREE Full Text
  7. ↵
    1. Chagot, B.,
    2. Potet, F.,
    3. Balser, J. R. and
    4. Chazin, W. J.
    (2009). Solution NMR structure of the C-terminal EF-hand domain of human cardiac sodium channel NaV1.5. J. Biol. Chem. 284, 6436-6445. doi:10.1074/jbc.M807747200
    OpenUrlAbstract/FREE Full Text
  8. ↵
    1. DeCaen, P. G.,
    2. Delling, M.,
    3. Vien, T. N. and
    4. Clapham, D. E.
    (2013). Direct recording and molecular identification of the calcium channel of primary cilia. Nature 504, 315-318. doi:10.1038/nature12832
    OpenUrlCrossRefPubMedWeb of Science
  9. ↵
    1. DeCaen, P. G.,
    2. Liu, X.,
    3. Abiria, S. and
    4. Clapham, D. E.
    (2016). Atypical calcium regulation of the PKD2-L1 polycystin ion channel. Elife 5, e13413. doi:10.7554/eLife.13413
    OpenUrlCrossRefPubMed
  10. ↵
    1. Delling, M.,
    2. DeCaen, P. G.,
    3. Doerner, J. F.,
    4. Febvay, S. and
    5. Clapham, D. E.
    (2013). Primary cilia are specialized calcium signalling organelles. Nature 504, 311-314. doi:10.1038/nature12833
    OpenUrlCrossRefPubMedWeb of Science
  11. ↵
    1. DeMaria, C. D.,
    2. Soong, T. W.,
    3. Alseikhan, B. A.,
    4. Alvania, R. S. and
    5. Yue, D. T.
    (2001). Calmodulin bifurcates the local Ca2+ signal that modulates P/Q-type Ca2+ channels. Nature 411, 484-489. doi:10.1038/35078091
    OpenUrlCrossRefPubMedWeb of Science
  12. ↵
    1. Fanger, C. M.,
    2. Ghanshani, S.,
    3. Logsdon, N. J.,
    4. Rauer, H.,
    5. Kalman, K.,
    6. Zhou, J.,
    7. Beckingham, K.,
    8. Chandy, K. G.,
    9. Cahalan, M. D. and
    10. Aiyar, J.
    (1999). Calmodulin mediates calcium-dependent activation of the intermediate conductance KCa channel, IKCa1. J. Biol. Chem. 274, 5746-5754. doi:10.1074/jbc.274.9.5746
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Gardill, B. R.,
    2. Rivera-Acevedo, R. E.,
    3. Tung, C.-C.,
    4. Okon, M.,
    5. McIntosh, L. P. and
    6. Van Petegem, F.
    (2018). The voltage-gated sodium channel EF-hands form an interaction with the III-IV linker that is disturbed by disease-causing mutations. Sci. Rep. 8, 4483. doi:10.1038/s41598-018-22713-y
    OpenUrlCrossRefPubMed
  14. ↵
    1. Grantham, J. J.
    (2001). Polycystic kidney disease: from the bedside to the gene and back. Curr. Opin Nephrol. Hypertens. 10, 533-542. doi:10.1097/00041552-200107000-00008
    OpenUrlCrossRefPubMedWeb of Science
  15. ↵
    1. Grieben, M.,
    2. Pike, A. C.,
    3. Shintre, C. A.,
    4. Venturi, E.,
    5. El-Ajouz, S.,
    6. Tessitore, A.,
    7. Shrestha, L.,
    8. Mukhopadhyay, S.,
    9. Mahajan, P.,
    10. Chalk, R. et al.
    (2017). Structure of the polycystic kidney disease TRP channel Polycystin-2 (PC2). Nat. Struct. Mol. Biol. 24, 114-122. doi:10.1038/nsmb.3343
    OpenUrlCrossRefPubMed
  16. ↵
    1. Guo, W.,
    2. Sun, B.,
    3. Xiao, Z.,
    4. Liu, Y.,
    5. Wang, Y.,
    6. Zhang, L.,
    7. Wang, R. and
    8. Chen, S. R.
    (2016). The EF-hand Ca2+ binding domain is not required for cytosolic Ca2+ activation of the cardiac ryanodine receptor. J. Biol. Chem. 291, 2150-2160. doi:10.1074/jbc.M115.693325
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Happé, H. and
    2. Peters, D. J.
    (2014). Translational research in ADPKD: lessons from animal models. Nat Rev Nephrol 10, 587-601. doi:10.1038/nrneph.2014.137
    OpenUrlCrossRefPubMed
  18. ↵
    1. Hildebrandt, F. and
    2. Zhou, W.
    (2007). Nephronophthisis-associated ciliopathies. J. Am. Soc. Nephrol. 18, 1855-1871. doi:10.1681/ASN.2006121344
    OpenUrlAbstract/FREE Full Text
  19. ↵
    1. Hildebrandt, F.,
    2. Benzing, T. and
    3. Katsanis, N.
    (2011). Ciliopathies. N. Engl. J. Med. 364, 1533-1543. doi:10.1056/NEJMra1010172
    OpenUrlCrossRefPubMedWeb of Science
  20. ↵
    1. Horii, T.,
    2. Arai, Y.,
    3. Yamazaki, M.,
    4. Morita, S.,
    5. Kimura, M.,
    6. Itoh, M.,
    7. Abe, Y. and
    8. Hatada, I.
    (2014). Validation of microinjection methods for generating knockout mice by CRISPR/Cas-mediated genome engineering. Sci. Rep. 4, 4513. doi:10.1038/srep04513
    OpenUrlCrossRefPubMed
  21. ↵
    1. Irazabal, M. V.,
    2. Mishra, P. K.,
    3. Torres, V. E. and
    4. Macura, S. I.
    (2015). Use of ultra-high field MRI in small rodent models of polycystic kidney disease for in vivo phenotyping and drug monitoring. J. Vis. Exp. 100, e52757. doi:10.3791/52757
    OpenUrlCrossRef
  22. ↵
    1. Johnson, C. N.,
    2. Potet, F.,
    3. Thompson, M. K.,
    4. Kroncke, B. M.,
    5. Glazer, A. M.,
    6. Voehler, M. W.,
    7. Knollmann, B. C.,
    8. George, A. L., Jr. and
    9. Chazin, W. J.
    (2018). A mechanism of calmodulin modulation of the human cardiac sodium channel. Structure 26, 683-694.e683. doi:10.1016/j.str.2018.03.005
    OpenUrlCrossRef
  23. ↵
    1. Kleene, N. K. and
    2. Kleene, S. J.
    (2012). A method for measuring electrical signals in a primary cilium. Cilia 1, 17. doi:10.1186/2046-2530-1-17
    OpenUrlCrossRefPubMed
  24. ↵
    1. Kleene, S. J. and
    2. Kleene, N. K.
    (2017). The native TRPP2-dependent channel of murine renal primary cilia. Am. J. Physiol. Renal. Physiol. 312, F96-F108. doi:10.1152/ajprenal.00272.2016
    OpenUrlCrossRefPubMed
  25. ↵
    1. Koptides, M.,
    2. Hadjimichael, C.,
    3. Koupepidou, P.,
    4. Pierides, A. and
    5. Constantinou Deltas, C.
    (1999). Germinal and somatic mutations in the PKD2 gene of renal cysts in autosomal dominant polycystic kidney disease. Hum. Mol. Genet. 8, 509-513. doi:10.1093/hmg/8.3.509
    OpenUrlCrossRefPubMed
  26. ↵
    1. Koulen, P.,
    2. Cai, Y.,
    3. Geng, L.,
    4. Maeda, Y.,
    5. Nishimura, S.,
    6. Witzgall, R.,
    7. Ehrlich, B. E. and
    8. Somlo, S.
    (2002). Polycystin-2 is an intracellular calcium release channel. Nat. Cell Biol. 4, 191-197. doi:10.1038/ncb754
    OpenUrlCrossRefPubMedWeb of Science
  27. ↵
    1. Kuo, I. Y.,
    2. Brill, A. L.,
    3. Lemos, F. O.,
    4. Jiang, J. Y.,
    5. Falcone, J. L.,
    6. Kimmerling, E. P.,
    7. Cai, Y.,
    8. Dong, K.,
    9. Kaplan, D. L.,
    10. Wallace, D. P. et al.
    (2019). Polycystin 2 regulates mitochondrial Ca2+ signaling, bioenergetics, and dynamics through mitofusin 2. Sci. Signal. 12, eaat7397. doi:10.1126/scisignal.aat7397
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. Lee, C. H. and
    2. MacKinnon, R.
    (2018). Activation mechanism of a human SK-calmodulin channel complex elucidated by cryo-EM structures. Science 360, 508-513. doi:10.1126/science.aas9466
    OpenUrlAbstract/FREE Full Text
  29. ↵
    1. Lee, A.,
    2. Wong, S. T.,
    3. Gallagher, D.,
    4. Li, B.,
    5. Storm, D. R.,
    6. Scheuer, T. and
    7. Catterall, W. A.
    (1999). Ca2+/calmodulin binds to and modulates P/Q-type calcium channels. Nature 399, 155-159. doi:10.1038/20194
    OpenUrlCrossRefPubMedWeb of Science
  30. ↵
    1. Liu, X.,
    2. Vien, T.,
    3. Duan, J.,
    4. Sheu, S. H.,
    5. DeCaen, P. G. and
    6. Clapham, D. E.
    (2018). Polycystin-2 is an essential ion channel subunit in the primary cilium of the renal collecting duct epithelium. Elife 7, e33183. doi:10.7554/eLife.33183.031
    OpenUrlCrossRefPubMed
  31. ↵
    1. Ma, M.,
    2. Tian, X.,
    3. Igarashi, P.,
    4. Pazour, G. J. and
    5. Somlo, S.
    (2013). Loss of cilia suppresses cyst growth in genetic models of autosomal dominant polycystic kidney disease. Nat. Genet. 45, 1004-1012. doi:10.1038/ng.2715
    OpenUrlCrossRefPubMed
  32. ↵
    1. Menezes, L. F. and
    2. Germino, G. G.
    (2013). Murine models of polycystic kidney disease. Drug Discov. Today Dis. Mech. 10, e153-e158. doi:10.1016/j.ddmec.2013.10.002
    OpenUrlCrossRefPubMed
  33. ↵
    1. Mizuno, K.,
    2. Shiozawa, K.,
    3. Katoh, T. A.,
    4. Minegishi, K.,
    5. Ide, T.,
    6. Ikawa, Y.,
    7. Nishimura, H.,
    8. Takaoka, K.,
    9. Itabashi, T.,
    10. Iwane, A. H. et al.
    (2020). Role of Ca2+ transients at the node of the mouse embryo in breaking of left-right symmetry. Sci. Adv. 6, eaba1195. doi:10.1126/sciadv.aba1195
    OpenUrlFREE Full Text
  34. ↵
    1. Mochizuki, T.,
    2. Wu, G.,
    3. Hayashi, T.,
    4. Xenophontos, S. L.,
    5. Veldhuisen, B.,
    6. Saris, J. J.,
    7. Reynolds, D. M.,
    8. Cai, Y.,
    9. Gabow, P. A.,
    10. Pierides, A. et al.
    (1996). PKD2, a gene for polycystic kidney disease that encodes an integral membrane protein. Science 272, 1339-1342. doi:10.1126/science.272.5266.1339
    OpenUrlAbstract
  35. ↵
    1. Morick, D.,
    2. Schatz, M.,
    3. Hubrich, R.,
    4. Hoffmeister, H.,
    5. Krefft, A.,
    6. Witzgall, R. and
    7. Steinem, C.
    (2013). Phosphorylation of C-terminal polycystin-2 influences the interaction with PIGEA14: a QCM study based on solid supported membranes. Biochem. Biophys. Res. Commun. 437, 532-537. doi:10.1016/j.bbrc.2013.06.105
    OpenUrlCrossRefPubMed
  36. ↵
    1. Nachury, M. V. and
    2. Mick, D. U.
    (2019). Establishing and regulating the composition of cilia for signal transduction. Nat. Rev. Mol. Cell Biol. 20, 389-405. doi:10.1038/s41580-019-0116-4
    OpenUrlCrossRefPubMed
  37. ↵
    1. Nejatbakhsh, N. and
    2. Feng, Z. P.
    (2011). Calcium binding protein-mediated regulation of voltage-gated calcium channels linked to human diseases. Acta Pharmacol. Sin. 32, 741-748. doi:10.1038/aps.2011.64
    OpenUrlCrossRefPubMed
  38. ↵
    1. Ostrowski, L. E.,
    2. Blackburn, K.,
    3. Radde, K. M.,
    4. Moyer, M. B.,
    5. Schlatzer, D. M.,
    6. Moseley, A. and
    7. Boucher, R. C.
    (2002). A proteomic analysis of human cilia: identification of novel components. Mol. Cell. Proteomics 1, 451-465. doi:10.1074/mcp.M200037-MCP200
    OpenUrlAbstract/FREE Full Text
  39. ↵
    1. Park, E. Y. J.,
    2. Baik, J. Y.,
    3. Kwak, M. and
    4. So, I.
    (2019). The role of calmodulin in regulating calcium-permeable PKD2L1 channel activity. Korean J. Physiol. Pharmacol. 23, 219-227. doi:10.4196/kjpp.2019.23.3.219
    OpenUrlCrossRef
  40. ↵
    1. Pazour, G. J.,
    2. Agrin, N.,
    3. Leszyk, J. and
    4. Witman, G. B.
    (2005). Proteomic analysis of a eukaryotic cilium. J. Cell Biol. 170, 103-113. doi:10.1083/jcb.200504008
    OpenUrlAbstract/FREE Full Text
  41. ↵
    1. Pei, Y.
    (2001). A “two-hit” model of cystogenesis in autosomal dominant polycystic kidney disease? Trends Mol. Med. 7, 151-156. doi:10.1016/S1471-4914(01)01953-0
    OpenUrlCrossRefPubMedWeb of Science
  42. ↵
    1. Petri, E. T.,
    2. Celic, A.,
    3. Kennedy, S. D.,
    4. Ehrlich, B. E.,
    5. Boggon, T. J. and
    6. Hodsdon, M. E.
    (2010). Structure of the EF-hand domain of polycystin-2 suggests a mechanism for Ca2+-dependent regulation of polycystin-2 channel activity. Proc. Natl. Acad. Sci. USA 107, 9176-9181. doi:10.1073/pnas.0912295107
    OpenUrlAbstract/FREE Full Text
  43. ↵
    1. Qian, Q.,
    2. Hunter, L. W.,
    3. Li, M.,
    4. Marin-Padilla, M.,
    5. Prakash, Y. S.,
    6. Somlo, S.,
    7. Harris, P. C.,
    8. Torres, V. E. and
    9. Sieck, G. C.
    (2003). Pkd2 haploinsufficiency alters intracellular calcium regulation in vascular smooth muscle cells. Hum. Mol. Genet. 12, 1875-1880. doi:10.1093/hmg/ddg190
    OpenUrlCrossRefPubMedWeb of Science
  44. ↵
    1. Sammels, E.,
    2. Devogelaere, B.,
    3. Mekahli, D.,
    4. Bultynck, G.,
    5. Missiaen, L.,
    6. Parys, J. B.,
    7. Cai, Y.,
    8. Somlo, S. and
    9. De Smedt, H.
    (2010). Polycystin-2 activation by inositol 1,4,5-trisphosphate-induced Ca2+ release requires its direct association with the inositol 1,4,5-trisphosphate receptor in a signaling microdomain. J. Biol. Chem.. 285, 18794-18805. doi:10.1074/jbc.M109.090662
    OpenUrlAbstract/FREE Full Text
  45. ↵
    1. Santoso, N. G.,
    2. Cebotaru, L. and
    3. Guggino, W. B.
    (2011). Polycystin-1, 2, and STIM1 interact with IP(3)R to modulate ER Ca release through the PI3K/Akt pathway. Cell. Physiol. Biochem. 27, 715-726. doi:10.1159/000330080
    OpenUrlCrossRefPubMed
  46. ↵
    1. Schindelin, J.,
    2. Arganda-Carreras, I.,
    3. Frise, E.,
    4. Kaynig, V.,
    5. Longair, M.,
    6. Pietzsch, T.,
    7. Preibisch, S.,
    8. Rueden, C.,
    9. Saalfeld, S.,
    10. Schmid, B. et al.
    (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676-682. doi:10.1038/nmeth.2019
    OpenUrlCrossRefPubMedWeb of Science
  47. ↵
    1. Shah, V. N.,
    2. Wingo, T. L.,
    3. Weiss, K. L.,
    4. Williams, C. K.,
    5. Balser, J. R. and
    6. Chazin, W. J.
    (2006). Calcium-dependent regulation of the voltage-gated sodium channel hH1: intrinsic and extrinsic sensors use a common molecular switch. Proc. Natl. Acad. Sci. USA 103, 3592-3597. doi:10.1073/pnas.0507397103
    OpenUrlAbstract/FREE Full Text
  48. ↵
    1. Shen, B.,
    2. Zhang, W.,
    3. Zhang, J.,
    4. Zhou, J.,
    5. Wang, J.,
    6. Chen, L.,
    7. Wang, L.,
    8. Hodgkins, A.,
    9. Iyer, V.,
    10. Huang, X. et al.
    (2014). Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nat. Methods 11, 399-402. doi:10.1038/nmeth.2857
    OpenUrlCrossRefPubMedWeb of Science
  49. ↵
    1. Shen, P. S.,
    2. Yang, X.,
    3. DeCaen, P. G.,
    4. Liu, X.,
    5. Bulkley, D.,
    6. Clapham, D. E. and
    7. Cao, E.
    (2016). The structure of the polycystic kidney disease channel PKD2 in lipid nanodiscs. Cell 167, 763-773.e711. doi:10.1016/j.cell.2016.09.048
    OpenUrlCrossRefPubMed
  50. ↵
    1. Streets, A. J.,
    2. Needham, A. J.,
    3. Gill, S. K. and
    4. Ong, A. C.
    (2010). Protein kinase D-mediated phosphorylation of polycystin-2 (TRPP2) is essential for its effects on cell growth and calcium channel activity. Mol. Biol. Cell 21, 3853-3865. doi:10.1091/mbc.e10-04-0377
    OpenUrlAbstract/FREE Full Text
  51. ↵
    1. Su, Q.,
    2. Hu, F.,
    3. Ge, X.,
    4. Lei, J.,
    5. Yu, S.,
    6. Wang, T.,
    7. Zhou, Q.,
    8. Mei, C. and
    9. Shi, Y.
    (2018). Structure of the human PKD1-PKD2 complex. Science 361, eaat9819. doi:10.1126/science.aat9819
    OpenUrlAbstract/FREE Full Text
  52. ↵
    1. Tran, N. T.,
    2. Sommermann, T.,
    3. Graf, R.,
    4. Trombke, J.,
    5. Pempe, J.,
    6. Petsch, K.,
    7. Kuhn, R.,
    8. Rajewsky, K. and
    9. Chu, V. T.
    (2019). Efficient CRISPR/Cas9-mediated gene knockin in mouse hematopoietic stem and progenitor cells. Cell Rep 28, 3510-3522.e3515. doi:10.1016/j.celrep.2019.08.065
    OpenUrlCrossRef
  53. ↵
    1. Vassilev, P. M.,
    2. Guo, L.,
    3. Chen, X.-Z.,
    4. Segal, Y.,
    5. Peng, J.-B.,
    6. Basora, N.,
    7. Babakhanlou, H.,
    8. Cruger, G.,
    9. Kanazirska, M.,
    10. Ye, C.-p. et al.
    (2001). Polycystin-2 is a novel cation channel implicated in defective intracellular Ca2+ homeostasis in polycystic kidney disease. Biochem. Biophys. Res. Commun. 282, 341-350. doi:10.1006/bbrc.2001.4554
    OpenUrlCrossRefPubMedWeb of Science
  54. ↵
    1. Venkatachalam, K. and
    2. Montell, C.
    (2007). TRP channels. Annu. Rev. Biochem. 76, 387-417. doi:10.1146/annurev.biochem.75.103004.142819
    OpenUrlCrossRefPubMedWeb of Science
  55. ↵
    1. Vien, T. N.,
    2. Wang, J.,
    3. Ng, L. C. T.,
    4. Cao, E. and
    5. DeCaen, P. G.
    (2020). Molecular dysregulation of ciliary polycystin-2 channels caused by variants in the TOP domain. Proc. Natl. Acad. Sci. USA 117, 10329-10338. doi:10.1073/pnas.1920777117
    OpenUrlAbstract/FREE Full Text
  56. ↵
    1. Wang, H.,
    2. Yang, H.,
    3. Shivalila, C. S.,
    4. Dawlaty, M. M.,
    5. Cheng, A. W.,
    6. Zhang, F. and
    7. Jaenisch, R.
    (2013). One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910-918. doi:10.1016/j.cell.2013.04.025
    OpenUrlCrossRefPubMedWeb of Science
  57. ↵
    1. Wang, C.,
    2. Chung, B. C.,
    3. Yan, H.,
    4. Wang, H.-G.,
    5. Lee, S.-Y. and
    6. Pitt, G. S.
    (2014). Structural analyses of Ca2+/CaM interaction with NaV channel C-termini reveal mechanisms of calcium-dependent regulation. Nat. Commun. 5, 4896. doi:10.1038/ncomms5896
    OpenUrlCrossRefPubMed
  58. ↵
    1. West, J. W.,
    2. Patton, D. E.,
    3. Scheuer, T.,
    4. Wang, Y.,
    5. Goldin, A. L. and
    6. Catterall, W. A.
    (1992). A cluster of hydrophobic amino acid residues required for fast Na+-channel inactivation. Proc. Natl. Acad. Sci. USA 89, 10910-10914. doi:10.1073/pnas.89.22.10910
    OpenUrlAbstract/FREE Full Text
  59. ↵
    1. Wilkes, M.,
    2. Madej, M. G.,
    3. Kreuter, L.,
    4. Rhinow, D.,
    5. Heinz, V.,
    6. De Sanctis, S.,
    7. Ruppel, S.,
    8. Richter, R. M.,
    9. Joos, F.,
    10. Grieben, M. et al.
    (2017). Molecular insights into lipid-assisted Ca2+ regulation of the TRP channel Polycystin-2. Nat. Struct. Mol. Biol. 24, 123-130. doi:10.1038/nsmb.3357
    OpenUrlCrossRefPubMed
  60. ↵
    1. Wilson, P. D.
    (2008). Mouse models of polycystic kidney disease. Curr. Top. Dev. Biol. 84, 311-350. doi:10.1016/S0070-2153(08)00606-6
    OpenUrlCrossRefPubMedWeb of Science
  61. ↵
    1. Wingo, T. L.,
    2. Shah, V. N.,
    3. Anderson, M. E.,
    4. Lybrand, T. P.,
    5. Chazin, W. J. and
    6. Balser, J. R.
    (2004). An EF-hand in the sodium channel couples intracellular calcium to cardiac excitability. Nat. Struct. Mol. Biol. 11, 219-225. doi:10.1038/nsmb737
    OpenUrlCrossRefPubMedWeb of Science
  62. ↵
    1. Wu, G.,
    2. D'Agati, V.,
    3. Cai, Y.,
    4. Markowitz, G.,
    5. Park, J. H.,
    6. Reynolds, D. M.,
    7. Maeda, Y.,
    8. Le, T. C.,
    9. Hou, H., Jr.,
    10. Kucherlapati, R. et al.
    (1998). Somatic inactivation of Pkd2 results in polycystic kidney disease. Cell 93, 177-188. doi:10.1016/S0092-8674(00)81570-6
    OpenUrlCrossRefPubMedWeb of Science
  63. ↵
    1. Wu, G.,
    2. Markowitz, G. S.,
    3. Li, L.,
    4. D'Agati, V. D.,
    5. Factor, S. M.,
    6. Geng, L.,
    7. Tibara, S.,
    8. Tuchman, J.,
    9. Cai, Y.,
    10. Park, J. H. et al.
    (2000). Cardiac defects and renal failure in mice with targeted mutations in Pkd2. Nat. Genet. 24, 75-78. doi:10.1038/71724
    OpenUrlCrossRefPubMedWeb of Science
  64. ↵
    1. Xia, X.-M.,
    2. Zeng, X. and
    3. Lingle, C. J.
    (2002). Multiple regulatory sites in large-conductance calcium-activated potassium channels. Nature 418, 880-884. doi:10.1038/nature00956
    OpenUrlCrossRefPubMedWeb of Science
  65. ↵
    1. Yang, Y. and
    2. Ehrlich, B. E.
    (2016). Structural studies of the C-terminal tail of polycystin-2 (PC2) reveal insights into the mechanisms used for the functional regulation of PC2. J. Physiol. 594, 4141-4149. doi:10.1113/JP270933
    OpenUrlCrossRefPubMed
  66. ↵
    1. Yang, Y.,
    2. Keeler, C.,
    3. Kuo, I. Y.,
    4. Lolis, E. J.,
    5. Ehrlich, B. E. and
    6. Hodsdon, M. E.
    (2015). Oligomerization of the polycystin-2 C-terminal tail and effects on its Ca2+-binding properties. J. Biol. Chem. 290, 10544-10554. doi:10.1074/jbc.M115.641803
    OpenUrlAbstract/FREE Full Text
  67. ↵
    1. Yu, Y.,
    2. Ulbrich, M. H.,
    3. Li, M.-H.,
    4. Buraei, Z.,
    5. Chen, X.-Z.,
    6. Ong, A. C.,
    7. Tong, L.,
    8. Isacoff, E. Y. and
    9. Yang, J.
    (2009). Structural and molecular basis of the assembly of the TRPP2/PKD1 complex. Proc. Natl. Acad. Sci. USA 106, 11558-11563. doi:10.1073/pnas.0903684106
    OpenUrlAbstract/FREE Full Text
  68. ↵
    1. Zhou, J.,
    2. Olcese, R.,
    3. Qin, N.,
    4. Noceti, F.,
    5. Birnbaumer, L. and
    6. Stefani, E.
    (1997). Feedback inhibition of Ca2+ channels by Ca2+ depends on a short sequence of the C terminus that does not include the Ca2+-binding function of a motif with similarity to Ca2+-binding domains. Proc. Natl. Acad. Sci. USA 94, 2301-2305. doi:10.1073/pnas.94.6.2301
    OpenUrlAbstract/FREE Full Text
  69. ↵
    1. Zhu, J.,
    2. Yu, Y.,
    3. Ulbrich, M. H.,
    4. Li, M.-h.,
    5. Isacoff, E. Y.,
    6. Honig, B. and
    7. Yang, J.
    (2011). Structural model of the TRPP2/PKD1 C-terminal coiled-coil complex produced by a combined computational and experimental approach. Proc. Natl. Acad. Sci. USA 108, 10133-10138. doi:10.1073/pnas.1017669108
    OpenUrlAbstract/FREE Full Text
Previous ArticleNext Article
Back to top
Previous ArticleNext Article

This Issue

RSSRSS

Keywords

  • ADPKD
  • Biophysics
  • Ca2+ regulation
  • Ion channels
  • Polycystin
  • Primary cilia

 Download PDF

Email

Thank you for your interest in spreading the word on Journal of Cell Science.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Disrupting polycystin-2 EF hand Ca2+ affinity does not alter channel function or contribute to polycystic kidney disease
(Your Name) has sent you a message from Journal of Cell Science
(Your Name) thought you would like to see the Journal of Cell Science web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Research Article
Disrupting polycystin-2 EF hand Ca2+ affinity does not alter channel function or contribute to polycystic kidney disease
Thuy N. Vien, Leo C. T. Ng, Jessica M. Smith, Ke Dong, Matteus Krappitz, Vladimir G. Gainullin, Sorin Fedeles, Peter C. Harris, Stefan Somlo, Paul G. DeCaen
Journal of Cell Science 2020 133: jcs255562 doi: 10.1242/jcs.255562 Published 24 December 2020
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools
Research Article
Disrupting polycystin-2 EF hand Ca2+ affinity does not alter channel function or contribute to polycystic kidney disease
Thuy N. Vien, Leo C. T. Ng, Jessica M. Smith, Ke Dong, Matteus Krappitz, Vladimir G. Gainullin, Sorin Fedeles, Peter C. Harris, Stefan Somlo, Paul G. DeCaen
Journal of Cell Science 2020 133: jcs255562 doi: 10.1242/jcs.255562 Published 24 December 2020

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Alerts

Please log in to add an alert for this article.

Sign in to email alerts with your email address

Article navigation

  • Top
  • Article
    • ABSTRACT
    • INTRODUCTION
    • RESULTS
    • DISCUSSION
    • MATERIALS AND METHODS
    • Acknowledgements
    • Footnotes
    • References
  • Figures & tables
  • Supp info
  • Info & metrics
  • PDF + SI
  • PDF

Related articles

Cited by...

More in this TOC section

  • An SNX10-dependent mechanism down-regulates fusion between mature osteoclasts
  • Combined heterogeneity in cell size and deformability promotes cancer invasiveness
  • Non-canonical ago loading of EV-derived exogenous single stranded miRNA in recipient cells
Show more RESEARCH ARTICLE

Similar articles

Subject collections

  • Cilia and Flagella
  • Cell Biology and Disease

Other journals from The Company of Biologists

Development

Journal of Experimental Biology

Disease Models & Mechanisms

Biology Open

Advertisement

Follow us on Instagram

Cell science is bursting with beautiful images and over on Instagram, we’re showing them off! Find both JCS and FocalPlane on Instagram for stories and techniques across cell biology.


An interview with Derek Walsh

Professor Derek Walsh is the guest editor of our new special issue Cell Biology of Host-Pathogen Interactions. In an interview, Derek tells us about his work in the field of DNA viruses, the impact of the pandemic on virology and what his role as Guest Editor taught him.


How to improve your scientific writing

"If you are a scientist and you want to succeed, you must become a writer."

How do scientists become master storytellers? We called on our journal Editors, proofreaders and contributors to our community sites for their advice on how to improve your scientific writing.


Meet the preLighters: Jennifer Ann Black

Following the theme of our latest special issue, postdoc Jennifer Ann Black studies replication stress and genome plasticity in Leishmania in Professor Luiz Tosi’s lab in Sao Paolo. We caught up with Jenn (virtually) to hear about her relocation to Brazil mid-pandemic, her research on parasites and what she enjoys about ‘preLighting’.

In our special issue, Chandrakar et al. and Rosazza et al. present their latest work on Leishmania.


Mole – The Corona Files

“There are millions of people around the world who continue to believe that the Terrible Pandemic is a hoax.”

Mole continues to offer his wise words to researchers on how to manage during the COVID-19 pandemic.


JCS and COVID-19

For more information on measures Journal of Cell Science is taking to support the community during the COVID-19 pandemic, please see here.

If you have any questions or concerns, please do not hestiate to contact the Editorial Office.

Articles

  • Accepted manuscripts
  • Issue in progress
  • Latest complete issue
  • Issue archive
  • Archive by article type
  • Special issues
  • Subject collections
  • Interviews
  • Sign up for alerts

About us

  • About Journal of Cell Science
  • Editors and Board
  • Editor biographies
  • Travelling Fellowships
  • Grants and funding
  • Journal Meetings
  • Workshops
  • The Company of Biologists

For Authors

  • Submit a manuscript
  • Aims and scope
  • Presubmission enquiries
  • Fast-track manuscripts
  • Article types
  • Manuscript preparation
  • Cover suggestions
  • Editorial process
  • Promoting your paper
  • Open Access
  • JCS Prize
  • Manuscript transfer network
  • Biology Open transfer

Journal Info

  • Journal policies
  • Rights and permissions
  • Media policies
  • Reviewer guide
  • Sign up for alerts

Contacts

  • Contact JCS
  • Subscriptions
  • Advertising
  • Feedback

Twitter   YouTube   LinkedIn

© 2021   The Company of Biologists Ltd   Registered Charity 277992