Table 2.

Oligonucleotides primers used in this study

Name Sequence
clb2-0* 5′-GGATCCTATAGATGTCCAACCCAA-3′
clb2-1* 5′-CGCGGATCCGAATTCATGAGTGAAACTGATAGTGGA-3′
clb2-2* 5′-CGCGGATCCGAATTCATGGACCTAGATGCAGAAGATGT-3′
clb2-3* 5′-CGCGGATCCGAATTCATGAATATTCATCAAAATCGAGATATC-3′
clb2-4* 5′-CGCGGATCCTCAGCGGCCGCCATGCAAGGTCATTATATCAT-3′
clb2-9† 5′-GCGCTCGAGTTCGGTATTTCTAACTTGAAGTTGACT-3′
clb2-10† 5′-GCGGTCGACCTAGATGCAGAAGATGTAAATGATCCA-3′
clb2-F/A‡ 5″-CATCGGATTGGGATAATTTAGGTTAGCTTTCAATGTCTTTAAAATG-3′
clb3-1§ 5′-CGCAGATCTGAATTCAAAATGCATCATAACTCACAGTC-3′
clb3-2§ 5′-CGCAGATCTTCCGGGTTGGGTTTATACAGGTC-3′
clb3-3§ 5′-CGCGGATCCGGATAAACAACCAGAGTTAAGA-3′
clb3-4§ 5′-CGCGAATTCAGCGGCCGCTGTTAGATCTTTCTACTCTGTG-3′
bud3-1¶ 5′-TTACGTGTTCGGGCTCTTATCTGGTTGCTAAAAGAGTATATTTACACCTCACCACGGATCCCCGGGTTAATTAA-3′
bud3-2¶ 5′-AATGTATACATTGCATTAAATTAAAAAGAAAAAAAAAATCAATAAAACACGAATTCGAGCTCGTTTAAAC-3′
bud3-3¶ 5′-TGGGAAACAGAACTGCGCTGTTGGTGGCCCAGAGAAACTGAAATTTTATCGGATCCCCGGGTTAATTAA-3′
Bud3-4** 5′-GCGCCGCCAGCTTCAAAAATTAACTTTCAAAGGTCACCATCCTATATTCGGATCCCCGGGTTAATTAA-3 ′
Bud3-5** 5′ATAATGGGCATCATGCTTATCTAAAACCACCCTCATTCCTTGAAAGAGGAATTCGAGCTCGTTTAAAC-3 ′
  • * Primers used for PCR amplification of truncated mutants of CLB2 (Δ132, Δ176, Δ213, Δ255). Underlined nucleotides correspond to restriction sites used for cloning into the pMJ200 vector and pRS316GAL1-HA3.

  • Primers used for the construction of the Δ176-213 internal deletion of CLB2. Underlined nucleotides correspond to the restriction sites used for the internal fusion (clb-9 and clb-10) and for cloning into the pMJ vectors and pRS316GAL1-HA3 (clb2-0 and clb2-14 or clb2-4).

  • Primers used for F354/A in vitro mutagenesis. Underlined nucleotides correspond to introduced mutations.

  • § Primers used for amplification of CLB3 full-length, C-ter and N-ter domains. Underlined are restriction sites for chimeras construction and cloning into pMJ300, and pRS316GAL1-HA3.

  • Primers used for PCR-based BUD3 deletion (1 and 2) and CFP tagging (3 and 2).

  • ** Primers used for PCR-based construction of the bud3Δ1221 allele.