Table 1.

Sequences of primers used for RT-PCR and Real time PCR

Sense primers (5′ to 3′) Antisense primers (5′ to 3′) Product size (bp)
RT-PCR
   K8 TGCAGAACATGAGCATTC CAGAGGATTAGGGCTGAT 342
   K18 GACGCTGAGACCACACT TCCATCTGTGCCTTGTAT 119
   K19 GTTCAGTACGCATTGGGTCA CTGAAGTCATCTGCAGCCAG 440
   K20 CAACAATGTCAACGTGGAGG GCGTTCTGTGTCACTCCTGA 385
   β-Actin TAAGATCATTGCTCCCCCTG TGCTCACAGAGATCCACCAG 484
Nested PCR
   K20 CCCAGAAGAACCTGCAAGAG ACGAGCCTTGACGTCCTCTA 210
Real time PCR
   K8 GGACATCGAGATCACCACCT TGAAGCCAGGGCTAGTGAGT 155
   K18 ATTGCCAGCTCTGGATTGAC GTCTCAGCGTCCCTGATTTC 200
   K19 CGGTGGAAGTTTTAGTGGGA AGTAGGAGGCGAGACGATCA 101
   L7 AAAGGCAAGGAGGAAGCTCATCT AATCTCAGTGCGGTACATCTGCCT 80