Table 1.

PCR primers used for RT-PCR and real-time RT-PCR analyses

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′) Product (bp) Annealing temperature (°C)
Adamts1 GGTCACATCATTCCTGGACAACG TGTTCACACACTTGCCGCTG 293 65
Adamts4 AGTCCCATTTCCCGCAGAAC TGGTTTGTCTAAGAGGCAGTGTCG 216 65
Adamts5 AACGAGTTTACGGGGATGGGTC ATGGAAGAGTCAGCCACCAAGAGG 301 65
Aggrecan TGGGTGGATGCAGAGAGACG TTCGAGGCTCTTCCCAGTCC 481 63
Biglycan AACCGTATCCGCAAAGTGCC AGTTCATTCAGGGTCTCAGGGAG 197 63
Brevican TCAAAGGGGTCGTCTTCCTCTAC AACAGGCTTCTCGTGGGTTCTG 213 63
Clusterin CTGGCATCATACATACGCTTTTCC ACTGTCGGGTCATCTTCACCTTC 301 63
Cspg3 GGAACCTACAGTGGCTTTGGAAG TATCAGAGTGCTGGGGATGTCC 334 63
Cspg4 ACCCTCATCAGGAAACCCTCAC TCACCGCCAATGTGGATAGG 310 63
Cspg5 TGACTTCACCCCCTTTGATGAG CCAGAGTATGCTGTGGAGGAACTG 221 63
Cspg6 TTCGTCCAGAGCAGCGATTG CCAGCACTTTCAAGGAGATTCATC 220 63
Decorin TGATTGTCATAGAACTGGGCGG ATTCCTTTCAGGCTGGCTGC 205 63
Fibronectin GCTCCTTCACAGATGTCCGAAC CCGTTTGAGTTGCCACCGTAAG 220 60
Frs2α GAGCCCGTTGTAGAAAGGAATAGTC ATCGCTGTCATAGCCAGTGTCC 537 65
Frs2β CCCTCCACAACAACAACAACG GGTTTCATCTTCCTCACCATCAGG 305 65
Gapdh ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 452 65
Glypican TCTGCTGCCCGATGACTATCTG TGACAGCCCGAGAACATTCTG 206 63
Lumican CAACAATTTGACCGAGTCCGTG TTAAATGAGTTTCCAGGCACGC 381 63
Mmp2 GACCTTGACCAGAACACCATCG GCTGTATTCCCGACCGTTGAAC 474 63
Mmp3 ACCAAGAGAGAGTGTGGATTCTGC TTGAGAGAGATGGAAACGGGC 385 65
Mmp7 AAGAGGGTTAGTTGGGGGACTGC GGAGTAAGTGTGGCTCAGGAGG 419 63
Mmp8 GGACATTCCTTGGGACTCTCTCAC TCAAATCTCAGGTGGGGGTCAC 200 63
Mmp9 AGAGATGTGCGTCTTCCCCTTC TCAGGTTTAGAGCCACGACCATAC 318 55
Mmp10 CCCTGGATTTTATGGAGATGCTC TTGGCTCGTGGAGAACCTGTAGAC 175 60
Mmp11 TTCAAGGCGGGCTTTGTGTG TCCACGAAGGAAGTAGGCATAGC 426 63
Mmp12 AGATTCATAAAGGCGAGGCTGAC TTTCACTGGGGCTCCATAGAGG 350 60
Mmp13 GGTCTTCTGGCACACGCTTTTC ATGGCATCAAGGGATAGGGCTG 332 63
Mmp14 AGGAATAACCAAGTGATGGACGG ATGAATGAGCCTCTGGGAGACTC 371 60
Perlecan CAATACGGAGCCTACTTTCAGGAC CTAATGAAGTCTTTGCTGCGGC 179 63
Syndecan1 TGACTTCACTGCTCGGGACAAG GTTTCATCCTCCACAACCTCTTTG 261 63
Syndecan2 TCTGACAACATCCCAACTGATTCC AACTTCCGTCCGCTTGAACAG 235 63
Syndecan4 GGACCTTCCCTGAGGTGATTTC TGCTGGACATGGACACTTTGTTG 183 63
Versican TAACTGTGAAGCCAGCCGTAGC TCCCCCATCTGTGAAACTTGG 293 63