Table 1.

Primer sequences

Name Genotype Phenotype Primers (5′-3′)
(wt)Cx26—ECFP/EYFP* Wild type - Forward: GCGAAGCTTATGGATTGGGGCACGCTGCA
Reverse: GCGGTCGACCATCCAACTGGCTTTTTTG
(wt)Cx30—ECFP/EYFP* Wild type - Forward: GCGAAGCTTATGGATTGGGGGACGCTGC
Reverse: GCGGTCGACCATCCGCTTGGGAAACCTG
(wt)Cx31—ECFP/EYFP* Wild type - Forward: GCGAAGCTTATGGACTGGAAGACACTC
Reverse: GCGGTCGACCATCCGATGGGGGTCAGGT
(wt)Cx30.3—ECFP/EYFP* Wild type - Forward: GCGAAGCTTATGAACTGGGCATTTCTGCA
Reverse: CGGTCGACCATCCTGGATACCCACCTGC
(D50N)Cx26—ECFP/EYFP D50N KID GGAGATGAGCAGGCCAACTTTGTCTGCAACACCCTGC
(G11R)Cx30—ECFP/EYFP G11R HED CGCTGCACACTTTCATCAGGGGTGTCAAC
  • * Restriction enzyme sites underlined.

  • The mutated site is bold and mutated codon underlined.