Table 2.

Oligonucleotides used in this study

Name Sequence (5′ to 3′)
Strain construction
   AC1 GGGGATCCATGGATTTCGGACCTTTGAAC
   AC2 GGGGATCCGCCAAAGCACCACTCACCTTACG
   NAC3 GGGGTACCCACGAATGTTTTGCGCGTGTC
   AC4 CGGGAGCTCGACCATATCTAGATGCCGATTCC
   CDC14 3HA GCTTGATATCATGTTTCTTTCCACTTAACTT
   cdc14Δ delete forward primer CAGATAGAATATACCTTGGCGCTTATGATCATCACAAAAGGGATACAGAAGATTTGGCATATTTCACAGTTGAAGACGCATTACCATATAATGCATTTTACGAAGCTTCGTACGCTGCAGGTC
   cdc14Δ delete reverse primer GTATACATTGATTTAATGAAGGTGAAGCAAAAAAGAAAGAATAACAAATAACAAATAAAAACAGGTTATCAAAAGAAATGAACTTAACATACATGTACAATCTGATATCATCGATGAATTCGAG
   ace2Δ delete forward primer ATGCATTGGAAATTTCTGAACTTTCGAAAGTACCATCTTTCTTTCCATTTAAATTTATTTGATCTTTCTGTGGAATTGTGAGCGGATA
   ace2Δ delete reverse primer ACTGAAATGCAATCTTCTCTCCCACTCGAGCAAACACTCTCTCCATGAAAAACCAACTTGTGGCAGAAGTTTCCCAGTCACGACGTT
   cdc10Δ delete forward primer TTATTTCCTTCTTTTCGTTTACGTTTTCGTTTTCGTTTTTTTTTAGGGTTGATTGATTCAAACTAATTCAAACACAAGTGTTCTTATAAGCCAAAACATCGAAGCTTCGTACGCTGCAGGTC
   cdc10Δ delete reverse primer ATTTTTGTTCATACGCGTTTTGCTTTTCAACAAACACACAAAAGAAGAGGAATACAAAAAAGTAAAATCACATTATATCAATAACAAACATTATTTATCTTCTGATATCATCGATGAATTCGAG
   CDC14-XFP forward primer GCGTGTCTAAAGCCAGATCCAAAAATAGGATCGCTTCTGGAAACTCACAAACATCAAGAGCACACTCTGGTGGTGTGAGAAAGTTAAGTGGAAAGAAACATGGTGCTGGCGCAGGTGCTTC
   CDC14-XFP reverse primer TGATATTGCTGAATTAAGTTTAAAGGATTTCGATATATTGGCTTTTGCATATGGTTCGGAAGAACAAATTGAAATTGTTGAACCAGCTTATGAAGAAAACTTCTGATATCATCGATGAATTCGAG
   ACE2-GFP forward primer GGGAACTAATAACACTCAACAACAATTGCTTAAAACAGATACAGTGGTTGAGAGGATAGAAAAACAGTTGCTACAGGAAGATAAGAGTGTTACTGAGGAGTTTTTAATGTTGCAAGGTGCTGGCGCAGGTGCTTC
   ACE2-GFP reverse primer CGATATAAAATAAAAAAGAATAATAGTATAATTTTGAAAAGGGTAAAATGAAATGAACTGAAATGCAATCTTCTCTCCCACTCGAGCAAACACTCTCTCCATGAAAAACCAACTTGTGGCAGAAGTTCTGATATCATCGATGAATTCGAG
   TUB2-XFP forward primer TGATTTGGTTAGTGAATACCAACAATACCAAGAAGCTAGTATTGATGAAGAAGAATTAGAATATGCCGATGAAATCCCATTAGAAGATGCCGCCATGGAAGGTGCTGGCGCAGGTGCTTC
   TUB2-XFP reverse primer GTTGATTTAGTTGGTGTATATATTTCATTTTTATTTTTGTAAATTATTATTGATATCAGTAGTGGTAAAGAATAGGACATCGTTAAATATATAAAAGTATTCTGATATCATCGATGCATTCGAG
   H2FA CAACGAAATGGCCTCCCCTACCACAG
   A2FA AATGGATCAGTGGCACCGGTG
   ARG1 CAATGGATCAGTGGCACCGG
   H3FA GGACGAATTGAAGAAAGCTGGTGCAACCG
   ACE2-5SB CGAGTATATTTGCCACC
   URA1 GGTATAGAAATGCTGGTTGG
   RCDC14-1 GCTCTAGAATGGATTTCGGACCTTTGAAC
   RCDC14-2 CGTCTAGACGAGTGGCCTATCCAAAAGAT
   CaACE5 TTCCATGCATTTATCACC
   GFP TCACCATCTAATTCAACC
   PCaHA-3 ACACATGCATGCTTAACCGGCATAGTCTGG
   G1-CDC14 CCAATTAACTCAACGTCTATC
   G4-TUB1 CGGTTTGAACAAAAGTAGGGATGC
   U2FA GCTGTAGTGCCATTGATTCGTAACAC
Northern probes
   ACT1-5 GGTTTTGCCGGTGACGAC
   ACT1-3 TCGAAATCCAAAGCAACG
   ECE1-1 TGGCAACATTCCACAAGTAATC
   ECE1-2 AGCCGGCATCTCTTTTAACTGG
   HWP1-1 TCAATTGGGGCCACTGTC
   HWP1-2 TGGAATCCAATCGGTTGG
   DSE1-5 CAAGGTGGGAATCCTAT
   DSE1-3 CTGTAATTGTTATGACC
   ACE2-5 GGTGGCAATTCTTACTC
   ACE2-3 GCATGGAACCTACATTTG
   CHT3-1 TTGTTTGTTGGTGTACCTGC
   CHT3-2 ATCACTAGTGGAAGCACTGG
   ENG1-5 GCACACTAATAGCCGTTCAAG
   ENG2-3 CTTTGTTGTAGAGACTAAGGA