Table 1.

Sequences and amplification conditions of primers used for real-time PCR quantification of DNA with the LightCycler

Primer name Sequence (5′-3′) Amplicon size (bp) TAnnealing (°C)
LB2-F GGCTGGCATGGACTTTCATTTCAG 232 66
LB2-R GTGGAGGGATCTTTCTTAGACATC
LB2C-F GTTACCAGTCAGGCGCATGGGCC 240 66
LB2C-R CCATCAGGGTCACCTCTGGTTCC
Myc11-F TATCTACACTAACATCCCACGCTCTG 192 62
Myc11-R CATCCTTGTCCTGTGAGTATAAATCATCG
Myc1-F TCTCAACCTCAGCACTGGTGACA 248 60
Myc1-R GACTTTGCTGTTTGCTGTCAGGCT
  • Names and sequences of primers used for real-time quantification of DNA with the LightCycler (Roche Diagnostics). The primer sets correspond to the amplification regions shown at the maps of the lamin B2 and c-myc origins (see Fig. 3A). `F' and `R' designate the forward and reverse primers, respectively. The size of the PCR products in base pairs (bp) and the annealing temperature (TAnnealing) used in the PCR cycling conditions in °C is also indicated.