Table 1.

Primers used for real-time PCR

Primer sequence (5′-3′)
Gene Forward Reverse
Mouse
   Cripto GCCTATGGGATTCCCTTCC ACAGCGGGATACAGGGACT
   Hes1 ACACCGGACAAACCAAAGAC CGCCTCTTCTCCATGATAGG
   Hes5 GATGCTCAGTCCCAAGGAGA AGCTTCAGCTGCTCTATGCTG
   Hesr1 CATGAAGAGAGCTCACCCAGA CGCCGAACTCAAGTTTCC
   Hesr2 GTGGGGAGCGAGAACAATTA GTTGTCGGTGAATTGGACCT
   Hesr3 CTGAATTGCGACGATTGGT GCAAGACCTCAGCTTTCTCC
   Nodal CCAACCATGCCTACATCCA CACAGCACGTGGAAGGAAC
   Sox1 GTGACATCTGCCCCCATC GAGGCCAGTCTGGTGTCAG
   Wnt1 TACTGGCACTGACCGCTCT CTTGGAATCCGTCAACAGGT
   Wnt3 CTCGCTGGCTACCCAATTT GAGGCCAGAGATGTGTACTGC
   β-actin CTAAGGCCAACCGTGAAAAG ACCAGAGGCATACAGGGACA
Human
   BF1 TACTACCGCGAGAACAAGCA TCACGAAGCACTTGTTGAGG
   CHX10 GCTGGACACCAGCCAGAC GCAGATTTGGACATTTTTCGAT
   CRALBP AGATCTCAGGAAGATGGTGGAC GAAGTGGATGGCTTTGAACC
   CRX CACCAGGCTGTGCCCTAC CTTCCAGCTCCTCCAGTTG
   GBX2 AAAGAGGGCTCGCTGCTC ATCGCTCTCCAGCGAGAA
   HOXB4 TGGATGCGCAAAGTTCAC GCTGGACACCAGCCAGAC
   IRX3 AAAAGTTACTCAAGACAGCTTTCCA GAAATTCCTTCTCCAGCTCCA
   MITF AGAGTCTGAAGCAAGAGCACTG TGCGGTCATTTATGTTAAATCTTC
   NANOG ATGCCTCACACGGAGACTGT AGGGCTGTCCTGAATAAGCA
   OCT3/4 GCAAAACCCGGAGGAGGAGTC CCACATCGGCCTGTGTATATC
   PAX6 TCACCATGGCAAATAACCTG CAGCATGCAGGAGTATGAGG
   RCVRN TAACGGGACCATCAGCAAG CCTCGGGAGTGATCATTTTG
   RPE65 CAATGGGTTTCTGATTGTGGA CCAGTTCTCACGTAAATTGGCTA
   RX GGCAAGGTCAACCTACCAGA CTTCATGGAGGACACTTCCAG
   SIX3 CCGGAAGAGTTGTCCATGTT CTCCTCCAGCGTCTCACAG
   β-actin ATTGGCAATGAGCGGTTC GGATGCCACAGGACTCCA