Table 2.

Primers used for RT-PCR

Primer sequence (5′-3′)
Gene Forward Reverse
CRALBP AGATCTCAGGAAGATGGTGGAC GAAGTGGATGGCTTTGAACC
CRX GCCCCACTATTCTGTCAACG CTTCCAGCTCCTCCAGTTG
NRL GAGCCCAGAGGAGACAGGA TTTAGCTCCCGCACAGACAT
PDC TCAAAGGAACGAGTCAGCAG CTGCTGCAAGGCATGTTAAA
PDE6b CAGTGATGAACACCGACACC ATTTGACCAGGTCCAGTTCG
PDE6c CTGAGGTGGCCTCTAGGTTG GCTGGTGTGATGAAGCCTTAG
RCVRN TAACGGGACCATCAGCAAG CCTCGGGAGTGATCATTTTG
RHO CACCAGGCTGTGCCCTAC GCCTCATCGTCACCCAGT
GRK1 GGACTGGTTCCTGGACTTCA AAGCCAGGGTTCTCCTCATT
RPE65 CAATGGGTTTCTGATTGTGGA CCAGTTCTCACGTAAATTGGCTA
SAG CTGATCCGCAAAGTACAGCA TCAGCGTCTTGGTCAAAGTG
GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA